|
Register | Sign In |
|
QuickSearch
Thread ▼ Details |
Member (Idle past 1499 days) Posts: 2161 From: Cambridgeshire, UK. Joined: |
|
Thread Info
|
|
|
Author | Topic: What is design ? | |||||||||||||||||||||||
Peter Member (Idle past 1499 days) Posts: 2161 From: Cambridgeshire, UK. Joined: |
I another topic I had a brief discussion that made me
question my assumptions about the common meaning ascribed to the word 'Design'. What does it mean to be 'Designed', and what act is 'to design' ? It was suggested that repeating patterns might indicatedesign, but that would make a snowflake or crystal a designed object (IDer's probably go 'Well it is!!'). What does design mean to those who debate here ?
|
|||||||||||||||||||||||
Peter Member (Idle past 1499 days) Posts: 2161 From: Cambridgeshire, UK. Joined: |
I'm bumping this, because I feel the lack of responses
from supporters of ID on what IS design suggests that they don't actualy know. If you can't tell if something is designed, you haveno foundation for ID (except faith).
|
|||||||||||||||||||||||
nator Member (Idle past 2190 days) Posts: 12961 From: Ann Arbor Joined: |
quote: It's the same question I always ask and it thus far has not been answered: How do you tell the difference between an Intelligently Designed system and a natural system we don't understand?
|
|||||||||||||||||||||||
Quetzal Member (Idle past 5892 days) Posts: 3228 Joined: |
Schraf: I keep asking a similar question concerning Dembski's specified complexity. To wit: How does the EF differentiate between "apparent" specified complexity (i.e., naturally occurring) and "true" specified complexity (i.e., design)? The supposed answer deals with the probability of occurance - but without knowing the causal history, the only way to distinguish the two is deciding in advance that something is designed. Tautology in action, IMO.
|
|||||||||||||||||||||||
Peter Member (Idle past 1499 days) Posts: 2161 From: Cambridgeshire, UK. Joined: |
Bumping this really ... what is intelligent design
without a set of design criteria ? I can see how signs of manufacture could indicatedesign (tool marks etc.), but ID seems to make a lot of references to complexity, when complexity and design are unrelated. Saying that for something to be designed it must be specified,sounds like saying for something to be designed it must be designed.
|
|||||||||||||||||||||||
Peter Member (Idle past 1499 days) Posts: 2161 From: Cambridgeshire, UK. Joined: |
Hello ...any IDer's out there ?
If you claim that life shows design, tell me what designis. If you cannot then there is no scientific foundation forID. |
|||||||||||||||||||||||
monkenstick Inactive Member |
I don't know the answer, but I've been told by a creationist that apparently this is design;
Human Urate Oxidase Psuedogene CDS (exons 1-8) atggcccact accataacaa ctataaaaaga atgatgagg tggagtttgt ccgaactggc tatgggaagg aaatggtaaa agttctccat attcagtgag atggaaaata tcacagcatt aaagaggtgg caacttcagt gcaacttact ctaagttcca aaaaagatta cctgcatgga gataattcag acatcatccc tacagacacc atcaagaaca cagttcatgt cttggcaaag tttaaagaa atcaaaagca tagaagcctt tggtgtgaat atttgtgagc attttctttc ttcttttaac catgtaatcc gagctcaagt ctacatggaa gaaatccctt ggaagcatct tggaaag aatggagtta agcatgtcca tgcatttatt cacactccca ctggaacaca cttctgtgaa gttgaacagc tgagaagt ggaccccaag tcattcattc tggaatcaaa gacctcaagg tcttgaaaac aacacagtct ggatttgaag gtttcatcaa ggaccagttc actaccctcc ctgaggtgaa ggactgatgc tttgccaccc aagtgtactg caagtggcgc taccaccagt gcagggatgt ggacttcaag gctacctgg gacaccattc gggaccttgt catggagaaa tctgctgggc cctatgacaa aggtgaatac ttgacctctg tgcagaagac cctctgtgat atccaggtgc tctccctgag ccgagttcct gcg atagaagata tggaaatcag cctgccaaac attcactact tcaacataga catgtccaaa atgggtctga tcaacaagga agaggtcttgctgc cattagacaa tccatatgga aaaattactg gtacagtcaa gaggaagttgtcttcaagac tgtga Translation: Met A H Y H N N Y K K N D E V E F V R T G Y G K E Met V K V L H I Q Stop D G K Y H S I K E V A T S V Q L T L S S K K D Y L H G D N S D I I P T D T I K N T V H V L A K F K E I K S I E A F G V N I C E H F L S S F N H V I R A Q V Y Met E E I P W K H L G K N G V K H V H A F I H T P T G T H F C E V E Q L R S G P Q V I H S G I K D L K V L K T T Q S G F E G F I K D Q F T T L P E V K D Stop C F A T Q V Y C K W R Y H Q C R D V D F K A T W D T I R D L V Met E K S A G P Y D K G E Y L T S V Q K T L C D I Q V L S L S R V P A I E D Met E I S L P N I H Y F N I D Met S K Met G L I N K E E V L L P L D N P Y G K I T G T V K R K L S S R L Stop I don't get it, I can't see the design in it. But according to the creationist I was arguing with, an intelligent designer did this
|
|||||||||||||||||||||||
blitz77 Inactive Member |
I've been wondering about one of the common topics debated about- reproduction and sex. How could evolution explain meiosis and mitosis? It is a bit hard to believe that they evolved step by step. If even only 1 stage is missing, it won't work and there is no point to it. Below is meiosis-
PROPHASE I: homologous chromosomes pair, split into CHROMATIDS, and carry out CROSSING OVER. The nuclear membrane disintegrates. METAPHASE I: chromosomes migrate to the spindle equator to whichthey become attached by their CENTROMERES. ANAPHASE I: HOMOLOGOUS CHROMOSOMES separate to oppositepoles. TELOPHASE I: new nuclei form, in which there is only one type of eachchromosome, although each is divided into two chromatids. PROPHASE II: nuclear membrane goes. METAPHASE II: chromosomes attach to spindle. ANAPHASE II: chromatids separate to poles. TELOPHASE II: a total of four haploid nuclei is produced, each with oneof each types of chromosome. I mean-most of the explanations I've seen talk about the advantages of sex - after it has arisen. Eg, allowing genetic recombination.
quote: and years later-
quote:
|
|||||||||||||||||||||||
Tranquility Base Inactive Member |
Monkenstick
Becasue you think the genomes are just fairy floss you think that the way we work is somehow not systematic or mechanistic or whatever. It is simply not true. Do you want me to show you some code for how MS Office 2000 works? It looks like random junk too but mess up one byte and it fails to work. It would look like this and yet was definitely designed: 3A 84 26 94 D6 72 3E AE 27 E8B3 27 19 C3 1B 2C 7D B2 6C F3 etc That protein sequence you listed (if it were not coded by a pseudogene but a gene) will specifically fold to 3D shape and have a catalytic site and a binding site. The substrate molecule (presumably urate) will be attracted to the binding site and the catalytic site will oxidize it in some way. Do you realise genes such as the Urate Oxidase gene are in genomes for a very good reason? These metabolic genes are part of a cascade of catalytic reactions not unlike a factory assembly line. Every gene in your body either directly does a job in your body or is used to make another chemical that will then go and do that job! THE HUMAN GENOME IS NOT FAIRY FLOSS! It works in an extremely similar manner to a piece of software. You are grossly violating common sense to somehow think that becasue the DNA sequence looks random that it somehow is. It is most certianly not. You be the first one to randomize your DNA. A single base change in one bad spot and you will die prematurely or may never have been born. This type of misunderstanding is utter folly by you or whoever gave you the idea. Common sense should have told you that something about your post was very, very wrong. In your zeal to denounce creation you are willing to deny all of molecular biology that deomnstrates the fine-tuned mechanistic basis of life. Please accept this very tough assessment of your question in the spirit of education (and hair tearing) in which it was written. [This message has been edited by Tranquility Base, 08-04-2002]
|
|||||||||||||||||||||||
John Inactive Member |
quote: You mean to say that it actually works in the first place?
quote: I have to agree. Appearances can be deceiving. It isn't enough just to look at the sequence. You have to search for the code. What TB and I disagree on is how the code came to be not-random. ------------------http://www.hells-handmaiden.com
|
|||||||||||||||||||||||
monkenstick Inactive Member |
umm, tranquility, did you look at the translation of the pseudogene. Did you notice the premature stop codons?
You underestimate or misunderstand what i'm saying
|
|||||||||||||||||||||||
Tranquility Base Inactive Member |
^ Your post insinuated that genes look lke they are not designed and I explained why they are, or at least why it all works mechanistically. I'm extremely sorry if that is not what you were insinuating.
Yes it's a pseudogene becasue of the stop codons - but no-one is trying to say that is evidence of design. It's the gene prior to the mutation that is evidence of design. What are you insinuating then?
|
|||||||||||||||||||||||
monkenstick Inactive Member |
oh, I guess I should post the other half of the information
Chimpanzee Urate Oxidase Psuedogene (exons 1-8) atggcccact accataacaa ctataaaaag aatgatgagg tggagtttgt ccgaactggc tatgggaagg atatggtaaa agttctccat attcagtgag atggaaaata tcacagcatt aaagaggtgg caacttcagt gcaacttact ctaagttcca aaaaagatta cctgcatgga gataattcag acatcatccc tacagacacc atcaagaaca cagttcatgt cttggcaaag tttaaagaa atcaaaagca tagaagcctt tggtgtgaat atttgtgagc attttctttc ttcttttaac catgtaatcc gagctcaagt ctatgtggaa gaaatccctt ggaagcatct tgaaaag aatggagtta agcatgtcca tgcatttatt cacactccca ctggaacaca cttcggtgaa gttgaacagc tgagaagt ggaccccaag tcattcattc tggaatcaaa gacctcaagc tcttgaaaac aacacagtct ggatttgaag gtttcatcaa ggaccagttc actaccctcc ctgaggtgaa ggactgatgc tttgccaccc aagtgtactg caagtgacgc taccaccagt gcagggatgt ggacttcaag gctacctgg gacaccattc gggaccttgt catggagaaa tctgctgggc cctatgacaa agatgaatac tcgccctctg tgcagaagac cctctgtgat atccaggtgc tctccctgag ccgagttcct gcg atagaagata tggaaatcag cctgccaaac attcactact tcaacataga catgtccaaa atgggtctga tcaacaagga agag gtcttgctgc cattagacaa tccatatgga aaaattactg gtacagtcaa gaggaagttg tcttcaagac tgtga BLAST Pairwise Alignment of chimp/human urate oxidase pseudogene Score = 1702 bits (885), Expect = 0.0Identities = 905/915 (98%) Strand = Plus / Plus I was told the homology shown in the BLAST alignment was due to common design rather than common ancestry. Design implies function. Where is the function in the pseudogenes, they clearly don't function as urate oxidase anymore. So is there some new function? what kind of "intelligent" designer creates new function by crippling existing genes? Its illogical.
|
|||||||||||||||||||||||
Tranquility Base Inactive Member |
^ This extra information about your discussion explains a lot!
OK - the stop codons could easily have mutated into the sequence for both organisms. Are the bad stop codons in the same place?
|
|||||||||||||||||||||||
monkenstick Inactive Member |
Chimpanzee Urate Oxidase Psuedogene translated:
Met A H Y H N N Y K K N D E V E F V R T G Y G K D Met V K V L H I Q Stop D G K Y H S I K E V A T S V Q L T L S S K K D Y L H G D N S D I I P T D T I K N T V H V L A K F K E I K S I E A F G V N I C E H F L S S F N H V I R A Q V Y V E E I P W K H L E K N G V K H V H A F I H T P T G T H F G E V E Q L R S G P Q V I H S G I K D L K L L K T T Q S G F E G F I K D Q F T T L P E V K D Stop C F A T Q V Y C K Stop R Y H Q C R D V D F K A T W D T I R D L V Met E K S A G P Y D K D E Y S P S V Q K T L C D I Q V L S L S R V P A I E D Met E I S L P N I H Y F N I D Met S K Met G L I N K E E V L L P L D N P Y G K I T G T V K R K L S S R L Stop the chimpanzee sequence has one extra stop codon, but both share two premature stop codons. So if you're suggesting that mutation produced both of these independently in different species, any of your arguments based on "improbabilities" have less weight.
|
|
|
Do Nothing Button
Copyright 2001-2023 by EvC Forum, All Rights Reserved
Version 4.2
Innovative software from Qwixotic © 2024