Molecular Population Genetics and Diversity through Mutation

Chimps and humans have different characteristics, yet neither is broken. Chimps and humans differ by 40 million mutations, yet neither is broken. Your claims are contradicted by reality. You would first need to show that anything it loses is necessary. Then you need to answer a simple question. Why do you think chimps and humans are physically different from each other? Isn't it due to the genetic differences between the genomes of each species?

Ultimately, your definition is meaningless. If we went back to the common ancestor of chimps and humans and tracked every single mutation that accumulated in each lineage, you would call every one of those changes a loss in information. You would define human evolution, with our evolution of upright walking and big brains, as a loss in information.In the end, evolution works just fine with what you define as a loss in information. Evolution doesn't need to produce an increase in information, as you define it, in order to produce the biodiversity we see today.The analogy I have used before is a home run in baseball. Everyone defines it as hitting the ball over the fence on the fly. However, you come along and define it as hitting a ball 1,000 feet, and then claim that no one has ever hit a home run. However, no hitter needs to hit the ball 1,000 feet in order to jog around the bases, so your definition doesn't matter.

Then you would describe every mutation in both the chimp and human lineage as being a loss in genetic diversity, even though both lineages would be diverging from one another, resulting in two diverse species.Yet again, you have argued yourself out of the argument. You would describe the emergence of two diverse species originating from a common ancestor as a loss in diversity. You would describe the millions and billions of species that do exist and have existed as being less diverse than the single celled common ancestor that they all descend from. Yes, you do. You claim that mutations don't increase genetic diversity. 40 million mutations separate humans and chimps. Therefore, your claims have direct application to chimps and humans whether you like it or not. You describe it as a loss in genetic diversity, which is the same thing.

First off, you are already agreeing that mutations change traits:"I was talking about the formation of domestic breeds and how once you have the breed you've been developing you don't want mutations coming along because they would mess up the traits you've so carefully established."Also, you are admitting that mutations increase genetic diversity which then increases phenotypic diversity. Just because you don't personally find those changes to be aesthetically pleasing in a domesticated dog breed does not change the fact that mutations can and do increase both genetic and phenotypic diversity. Where did you show that those traits are necessary for the survival of the lineage?Humans lost the ability to run on all fours. Did that end the human species? Chimps share more DNA with humans than they do with other apes. That is relatedness. We are talking about what happens when mutations occur within those populations, which will happen because every individual within those populations is born with mutations.Edited by Taq, : No reason given.

Every single dog has its own specific genetic substrate since every dog is born with mutations. In the future, the descendants of these dogs will have DNA sequences that their ancestors did not, and they may very well look different from their ancestors because of it. Where did you show that mutations had nothing to do with it? Aren't the differences due to differences in DNA sequence?

Differences in DNA sequence are not responsible for the physical differences between species?Please explain this. How do you explain the cause for these physical differences? How do the physical differences that separate us from chimps "mess us up"? How does walking upright and having a big brain "mess us up"? As we have already shown, you would consider the billions of living dead species a "loss in genetic diversity" compared to a simple single celled common ancestor. Your definition of genetic diversity is meaningless. How are the 40 million mutations that separate humans and chimps destructive to both humans and chimps? Back up your claim. What I am not seeing is the actual evidence that every mutation which occurs in these dogs is destructive. All I see is you claiming it, and barking at anyone who dares to challenge it.Please show that every single mutation that happens in these dogs is destructive, and not a single mutation is beneficial. What breeders want has nothing to do with how evolution works. How do you differentiate between design similarity and genetic relatedness? What criteria do you use?

We observe mutations producing new and naturally occurring alleles all of the time.You have a serious problem with your argument. You want to claim that any change to the DNA sequence of a species' genome will cause irreparable harm. However, there are millions of changes that separate species, and they aren't harmful. How can you say that mutations producing those changes will cause harm? Again, you have the same problem. First, you haven't produced a single criteria for determining genetic relatedness, so your claim is hollow. Second, the reason that humans and chimps are different from one another is because of the DNA sequence differences between their genomes. How can you claim that changes in DNA sequence can not produce new species when that is exactly what we observe? Then how do you explain the physical differences between species? What is the cause if it isn't a difference in DNA sequence? Then how do you explain the physical differences between species if it isn't due to a difference in DNA sequence within their respective genomes? Take any of the 40 million mutations that separate humans and chimps and show us how the observed mechanisms of mutation could not produce those differences. Can you do that? Increases in genetic diversity also have to occur due to new mutations in each and every generation and in each and every individual. If two populations are kept apart and do not interbreed, this will necessarily result in each population become less like the other one over time. This is due to the accumulation of population specific mutations. We have directly observed this process occurring. For example, captive breeding populations of lab mice have diverged from one another over the last 60 years.As I described before, you would describe this divergence as a loss in genetic diversity. Therefore, your description is meaningless. Multiply this process over and over until you have millions of diverging species we have today, and you would call each and every step a loss in genetic diversity. What's the difference? If a mutation turns AGG into AGC, how would the effect be any different than if a supernatural creator turned that same AGG into AGC? As already shown, humans and chimps are not wrecked, even though they are separated by 40 million differences. Reality proves you wrong. Evidence?In humans, we observe that every human is born with about 50 mutations. Why would dogs be any different? Really? Let's use the peppered moths as an example. If you were breeding white moths, the mutation that produced black moths would "wreck the breed". However, in the real world that mutation was very beneficial to the moths when they found themselves in an environment darkened by soot from factories. Your analogy completely fails. What breeders want has nothing to do with what is and could be selected for in nature. Your basic argument doesn't have the basics, like a falsifiable list of criteria for determine what genetic relatedness is evidenced by.

I picked out some random human DNA and searched for that same sequence in the chimp genome. This is what I got:

Query  133   ACATACAGACTGTACATGTAAGCAAATTTAAAATGCAGTATTAAATCATAGCTCTATAGC  192
             |||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||
Sbjct  1     ACATACAGACTGTACATGTAAGCAAATTTAAAATGCAGTATTAAATCATAACTCTATAGC  60

Query  193   CGCCACTGTCTGGCCACAGCCCCGCGCTCCTCGCTGTCGCTTGTCATCTCGCACAGGGTG  252
             |||||||||||||||||||||||||||||||||||||| ||||||||| ||  |||||||
Sbjct  61    CGCCACTGTCTGGCCACAGCCCCGCGCTCCTCGCTGTCACTTGTCATCGCGTGCAGGGTG  120

Query  253   GTTCCGTTTCTGGTATTTGGTGCCGGAATTAAGCAACCACCATGTTGAGCAAAAAGGCAA  312
             |||||| ||||||||||||| |||||||||||||||||||||||||||||||||||||||
Sbjct  121   GTTCCGGTTCTGGTATTTGGCGCCGGAATTAAGCAACCACCATGTTGAGCAAAAAGGCAA  180

Now, which of those differences are you saying that the observed processes of mutation could not produce?

Then why don't you help us out. We start with Population A, which has a DNA sequence of "AAAAAAAAA" at a specific point in their genome for all members of the population.A new river forms and it splits the population in two. Since the species can't swim that well, there is no interbreeding between the pouplations. We call them Population B and Population C (or PB and PC for short).In PB, a mutation occurs in the genetic locus, resulting in the sequence "AAAATAAAA". This mutation is selected for, and it replaces the old allele. The same mutation is not selected for in PC.We now have two populations with a different allele at the same orthologous position.PB= AAAATAAAA
PC= AAAAAAAAANow, would you define this as a loss in genetic diversity?Edited by Taq, : No reason given.

If that is the case, then my accusation in an earlier post stands. If Faith watched each and every mutation and selection event from the universal common ancestor to all of the species diversity we see today, Faith would call that entire process a loss in genetic diversity.

Then which step are you saying that evolution can't do? Barrier to gene flow? Mutation? Selection?

You keep insisting that you can't change the human genome by one base without it causing all this harm, and yet there are chimps with 40 million changes and they are doing just fine. How do you explain that?You claim that mutations can't produce the differences seen between species, so I am asking you to prove it. Those are the differences between humans and chimps. Please show how mutations couldn't produce those differences.Edited by Taq, : No reason given.

Will it do the same thing no matter what the DNA sequence of the gene is? You seem to be veering away from your breeder's mentality. If the breeder wants a specific face type, wouldn't that be an example of a beneficial mutation?Edited by Taq, : No reason given.

I never said a thing about the rightness or wrongness of what breeders do, either. You keep making the claim that breeders are selecting for specific traits. If they are selecting for a short snout, and a mutation in Runx-2 produces the trait they were looking for, wouldn't that be a beneficial mutation? If not, what would be in this situation?Also, this would produce the very thing you called an increase in genetic complexity. Prior to the mutation in Runx-2, you had several populations of dogs that shared similar alleles. Let's call that allele "A". Along came this new mutation and produce allele B. In the isolated bulldog population, this mutation was selected for and replaced the A allele.Before
not bulldogs= allele A
bulldogs= allele AAfter mutation and selection
not bulldogs= allele A
bulldogs= allele BHow is that not an increase in genetic complexity? DNA sequence is not a verb. Sequence isn't something that a gene does. Sequence is what a gene is.We are also talking about mutations in the Runx-2 gene that change the phenotype. You keep claiming that mutations can't produce changes in phenotype, yet here we have one.

Yes, you do. You have already said that humans are looking for animals that look a certain way. Any mutation that changes the way they look would be selected against. That is exactly what this mutation does. Chimps are physically different from humans, are they not?Those physical differences are due to DNA sequence differences between our genomes, are they not?Mutations produce DNA sequence differences, do they not?The logic seems pretty straightforward to me. The evidence demonstrates that they aren't built in. They appear over time. You can't make this conclusion go away by stomping your feet and insisting otherwise. You are ignoring the biological processes that increase genetic diversity. You can't make claims about the whole process of evolution by only focusing on one part of it. You have to focus on the entire process, and that includes the observed and known production of mutations. It includes concepts like Ka/Ks ratios and the pattern of conserved sequences, which are evidence for random mutations and selection occurring over time.