How do you define the word Evolution?

Assuming you are referring to Jack Chick, why in the world would you get your science information from religious tracts?

By what measure? How do you determine how much information is in a DNA sequence? For example:ATTACCATGGTCCTAGAAGTTCGGCACAGTTAGTTCGAGCCTAATGTCACA
AATGACGCAGAACGCCAATGAGTGCCAGACATTAGGTGGAGTTCAGTTCG
GTAACGGAGAGACTCTGCGGCGTACTTAATTATGCATTTGAAACGCGCCCA
AGTGACGCTAGGCAAGTCAGAGCAGGTT CCCGTGTTAGCTTGAGGGTAHow much genetic information is in that sequence?Edited by Taq, : No reason given.

The question is why you would reject the conclusion of a universal common ancestor when we have mountains of evidence to support the conclusion. Why the obsession with definitions? Why would you expect a one sentence definition on Wikipedia to cover the entire breadth of the theory?

Actually, you're right; so I'll go back to something like my original definition of evolution. In biology, the word, "evolution" can't be separated from Darwin's theory, which obviously has common descent at it's core. The gratuitous, ubiquitous and misleading use of the word, "evolution" in the biological sciences is always an allusion to Darwinism, which I reject as false, useless and irrelevant.So to hell with ToE, just give me biology and I'll be happy. As Danno used to say, "Just the facts, ma'am." (Danno would have made an excellent biologist ... but a lousy evolutionist.) When I become King of Australia I'll ban the teaching of ToE at all levels of education, thereby draining the swamp that the once-noble science of biology has become, liberating and cleansing it from the mendacious theology of atheist cultism.Evolution = Biology + the atheist cult of Darwinism

Oh, that's not a very nice thing to say. And besides, would you call someone who took twelve years to complete seven years of primary school brainless?Edited by Dredge, : No reason given.

I agree, Taq, universal common ancestry is inseparable from both Darwin's theory of evolution and the modern synthesis. E.g. Theodosius Dobzhansky concedes that there could have been more than one original form of life but that only one survived as the universal common ancestor. Charles Darwin was building on the tree of life idea that preceded him and published by Erasmus Darwin.Common ancestry is a core of the definitions given by both Kerkut and Coyne that I previously quoted.Dredge is right. There is more than one definition of the theory of evolution. This leads to people claiming evolution has been proved when they are only talking about minor changes in allele frequencies, not even speciation let alone common ancestry.

Dredge, the lack of correlation between phenotype complexity and genome size is known as the C-Value Paradox. This has not been resolved yet but remember we are still learning about the genome. The ENCODE results were published in 2003 and there has been a lot of progress since then but there's still a long way to go. There is still no satisfactory evolutionary explanation for the c-value so we will probably have to wait for more research.Like you I believe that eventually we will find that a human contains more genetic information than an amoeba.[edit] This is probably an issue that is peripheral to the thread topic and should be addressed elsewhere.Edited by CRR, : No reason given.

Thank you for acknowledging that there's no way to determine whether organism A or organism B has more or less genetic information.I know that you're trying to fool people like yourself and Dredge by using sciencey sounding language; but sciencey sounding language is not science. We're not all too stupid to be fooled by sciencey sounding language, CRR.So, the honourable thing to do by you and Dredge would be to acknowledge that genetic information can't be measured at the moment. And that you can't say whether Organism A or Organism B has "more genetic information".

Actually, I complimented your accomplishments. Your last accomplishment was that your way of measuring "genetic information" lead to the conclusion that some forms of Amoebas have more genetic information than humans. I agree with that when it comes to intelligence. Remember your "infos"? Edited by Pressie, : No reason given.Edited by Pressie, : No reason given.

I can make such a claim and I just did. DNA is an instruction manual for building a machine. A human machine is much more complex than an amoeba machine, therefore much more information is needed in the human's instruction manual. Compare the contents of an instruction manual to build an mouse trap compared to the contents of instruction manual to build a space shuttle.Simple, common sense logic, my friend.Edited by Dredge, : No reason given.Edited by Dredge, : No reason given.Edited by Dredge, : No reason given.

Nope. Word salads, again. You don't want to answer the question. Quantify before saying "more". Quantify genetic information before saying "more" or "less". Edited by Pressie, : No reason given.

No, no, no; not Jack Chick! "Chicko" is the dog that lives next door to me; an American bull terrier. He talks to me and gives me all sorts of advice and infallible information.

I not sure. Perhaps 200 infos. But I'll show it to Chicko and let him work it out exactly.

I'm trying to figure out what you're trying to say. My car is a machine. It's got no inheritable DNA. My car doesn't have kiddies. What's your point?.

All living organisms are biological machines. DNA provides the instructions for building biological machines.