How do you define the word Evolution?

If you asked a person on the street about the theory of relativity they would probably say something very different than what the scientists say. Does that mean the theory of relativity is not a sound theory? Does that mean the scientists are wrong about relativity?

Why do creationists have such a fascination and obsession with definitions?

Assuming you are referring to Jack Chick, why in the world would you get your science information from religious tracts?

By what measure? How do you determine how much information is in a DNA sequence? For example:ATTACCATGGTCCTAGAAGTTCGGCACAGTTAGTTCGAGCCTAATGTCACA
AATGACGCAGAACGCCAATGAGTGCCAGACATTAGGTGGAGTTCAGTTCG
GTAACGGAGAGACTCTGCGGCGTACTTAATTATGCATTTGAAACGCGCCCA
AGTGACGCTAGGCAAGTCAGAGCAGGTT CCCGTGTTAGCTTGAGGGTAHow much genetic information is in that sequence?Edited by Taq, : No reason given.

The question is why you would reject the conclusion of a universal common ancestor when we have mountains of evidence to support the conclusion. Why the obsession with definitions? Why would you expect a one sentence definition on Wikipedia to cover the entire breadth of the theory?

Strange that you would characterize my posts in such a manner since I said the exact opposite.

Care to give an example? That a creationist would start a thread on the definition of evolution only further highlights the obsession that creationists have with definitions, as opposed to facts and science.

False. Darwin's book was all about descent with modification as caused by natural selection. Nowhere did he claim in the original book that all life shared a universal common ancestor. Can you please cite an earlier work that theorized descent with modification by natural selection?

Therefore, Darwinism did not include universal common descent as a required condition.

How is the fossil record "pseudo-evidence"?

The problem is that all he has is claims and no evidence.

And once again, we see creationists trying to make evolution look like their religious beliefs in order to discredit it. Shows you how much respect they have for their own beliefs.

They all say the same thing, so I don't understand what your problem is. Did you read the entire definition?""In the broadest sense, evolution is merely change, and so is all-pervasive; galaxies, languages, and political systems all evolve. Biological evolution ... is change in the properties of populations of organisms that transcend the lifetime of a single individual. The ontogeny of an individual is not considered evolution; individual organisms do not evolve. The changes in populations that are considered evolutionary are those that are inheritable via the genetic material from one generation to the next. Biological evolution may be slight or substantial; it embraces everything from slight changes in the proportion of different alleles within a population (such as those determining blood types) to the successive alterations that led from the earliest protoorganism to snails, bees, giraffes, and dandelions."It clearly defines what biological evolution is and differentiates it from changes in other systems. Yet another misrepresentation of our position. What we are saying is that the theory does not require a universal common ancestor. However, since the evidence does point to a universal common ancestor then it is part of the theory.

I suspect that we are saying the same thing.To put it another way, if there were multiple origins of life then the theory would change to reflect that reality while still proposing the same mechanisms of change.

It would change from a theory using a universal common ancestor to a theory with multiple common ancestors.As you said, the theory is a model of reality so the theory changes to fit what we learn about reality. The theory that Darwin first proposed was ambiguous to the number of common ancestors, but that theory changed as we discovered more about biological realities.