|
Register | Sign In |
|
QuickSearch
Thread ▼ Details |
Member (Idle past 1433 days) Posts: 20714 From: the other end of the sidewalk Joined: |
Thread Info
|
|
|
Author | Topic: MACROevolution vs MICROevolution - what is it? | |||||||||||||||||||||||
CRR Member (Idle past 2270 days) Posts: 579 From: Australia Joined: |
You don't have sperm and egg sex, but haploid duplicates the nucleus then divides into two gamets which then combine with other gametes to produce a diploid cell. Thanks for explaining that. Yes bring in Pelycodus again. As I showed before the difference between dogs of the SAME species is greater than the difference in the two varieties in the Pelycodus example. Even if it is speciation it does not show whether this was due to microevolution or macroevolution. It would at best show speciation within the kind which most Creationists have no problem with.
|
|||||||||||||||||||||||
CRR Member (Idle past 2270 days) Posts: 579 From: Australia Joined: |
Durston in the link previously given says that both "statistically significant" and "functional information" are measurable and provides links. Go back and re-read my previous posts.
Edited by CRR, : No reason given.
|
|||||||||||||||||||||||
CRR Member (Idle past 2270 days) Posts: 579 From: Australia Joined: |
Fell free to contact Durston yourself.
|
|||||||||||||||||||||||
CRR Member (Idle past 2270 days) Posts: 579 From: Australia Joined: |
... from Message 107
microevolution = changes in gene frequencies and trait distributions that occur within populations and species macroevolution = large evolutionary change, usually in morphology, typically refers to evolution of differences among populations that would warrant their plaecment in different genera or higher-level taxa
|
|||||||||||||||||||||||
CRR Member (Idle past 2270 days) Posts: 579 From: Australia Joined: |
But the principle is that to get a population of the new variety requires losing the genetic stuff for the other variety.
There is no requirement of evolution theory that the parent population go extinct (although this is often the eventual result).In the case of the Peppered Moth the white variety was never completely eliminated and today both varieties are common. However beneficial information adding mutations are very rare. Most cases of new varieties and species is due to partitioning of the original gene pool so that each of the new ones has less genetic diversity than the parent population.
|
|||||||||||||||||||||||
CRR Member (Idle past 2270 days) Posts: 579 From: Australia Joined: |
Speciation begins by the creation of two isolated populations of the OG population so that we have Species A and Species B
No, what we have is two isolated sub-populations of the OG species. Isolation does not immediately confer speciation. Now we have several hypothetical mutations. Probably neutral mutations that are fixed by genetic drift. So at the end you might have two alleles that have no effect on the phenotype and and still have one species. Perhaps you will have two varieties of the one species. Perhaps speciation will occur. Perhaps all that has occurred is that one variety has straight hair and the other has wavy hair. Perhaps H & I have accumulated so many defects they are now both non-functional. What we do know is that sometimes populations can develop significant changes in morphology in times too short to be attributed to the mutation selection mechanism; whether due to epigenetic changes or selection from the original gene pools. This sort of thing has been observed in Italian Wall Lizards, Trinidad Guppies, Galapagos Finches, and others.
That is macroevolution. We have reached the genetic divergence seen between what you would call separate kinds, and it all occurs through microevolution.
Probably not even separate species, let alone separate kinds; and hence not even macroevolution. One of the few observed examples of speciation I know of is the London Underground Mosquito, and that's still incipient speciation since complete reproductive isolation has not been achieved at last report I saw. Speciation is macroevolution IFF that is the definition accepted by all parties.
|
|||||||||||||||||||||||
CRR Member (Idle past 2270 days) Posts: 579 From: Australia Joined: |
RAZD writes:
Jerry Coyne has said that there are no ring species. Perhaps he didn't know about the Asian Greenish Warblers or perhaps their failure to interbreed has been exaggerated. We can use ring species, such as the Asian Greenish Warblers (Phylloscopus trochiloides) to demonstrate that it doesn't take much difference to create a behavior barrier to mating: ... A modest change in plumage and mating song and there is no breeding behavior between the two populations. This could be a good example of why we should not equate speciation with macroevolution. Other examples could be Lake Malawi cichlids that don't interbreed in the wild but do interbreed in captivity. Some butterflies exhibit similar behaviour.
|
|||||||||||||||||||||||
CRR Member (Idle past 2270 days) Posts: 579 From: Australia Joined: |
Here's what Jerry Coyne said;
quote: (So he did know about the greenish Warbler) I don't know what his opinion about "species complexes" is, or even what that means. Edited by CRR, : No reason given.
|
|||||||||||||||||||||||
CRR Member (Idle past 2270 days) Posts: 579 From: Australia Joined: |
a program described in Dawkin's The Blind Watchmaker
There are 2.
quote:
|
|||||||||||||||||||||||
CRR Member (Idle past 2270 days) Posts: 579 From: Australia Joined: |
Let's have a look at a simple hypothetical example. We will start with Species OG (for original gangster).
Species OG allele A TTTTTTTTTTTTTTTTTTTTSpeciation begins by the creation of two isolated populations of the OG population so that we have Sub Species OGa and Sub Species OGb Subspecies OGa allele A Subspecies OGb allele A TTTTTTTTTTTTTTTTTTTT TTTTTTTTTTTTTTTTTTTTMutation and selection occurs in each population, but since different mutations and selection pressures occur in each subspecies they end up with different alleles: Subspecies OGa allele B Subspecies OGb allele C TTTTTTTTTTTTTTTTATTT TTTTTTGTTTTTTTTTTTTTThose separate subspecies have now diverged, all through microevolution. This same process occurs again. Subspecies OGa allele D Subspecies OGb allele E TTCTTTTTTTTTTTTTATTT TTTTTTGTTTTTTTGTTTTTAnd it occurs again: Subspecies OGa allele F Subspecies OGb allele G TTCTTTTTGTTTTTTTATTT TATTTTGTTTTTTTGTTTTTAnd it occurs again: Subspecies OGa allele H Subspecies OGb allele I TTCTTATTGTTTTTTTATTT TATTTTGTTTTCTTGTTCTTLet's freeze time and compare these new subspecies with the OG species Subspecies OGa allele H Subspecies OGb allele I TTCTTATTGTTTTTTTATTT TATTTTGTTTTCTTGTTCTT Species OG allele A Species OG allele A TTTTTTTTTTTTTTTTTTTT TTTTTTTTTTTTTTTTTTTTNow when the isolated populations merge we have two different alleles. Note that no new genes have been created, just two corrupted versions of the original. Hence this can be regarded as microevolution. In most cases this won't prevent interbreeding; like blue eyed and brown eyed people can still have children. If however this and other changes hampers interbreeding you might get two separate species within the same kind; such as horses and donkeys. We have speciation by microevolution.This may well have been one of the mechanism by which the relatively few kinds on Noah's Ark developed into the much greater number of species we see today. Edited by CRR, : Amended last sentence.
|
|||||||||||||||||||||||
CRR Member (Idle past 2270 days) Posts: 579 From: Australia Joined: |
Faith writes:
That is so, and very few of the beneficial mutations are due to increases in genetic information. The understanding that mutations are predominantly neutral, many deleterious and a very very few beneficial is so commonly known I wouldn't expect to have to justify it. In fact many of what were regarded as neutral, where the same amino acid is coded for, may turn out to be detrimental. Sometimes the alternative coding is a Duon which will change the regulation of the gene; and sometimes it results in a transcription pause or the loss of one, which can hamper proper folding of the protein.
|
|||||||||||||||||||||||
CRR Member (Idle past 2270 days) Posts: 579 From: Australia Joined: |
Do you have any science to back up this assertion?
Yes.In the book "Biological Information: New Perspectives" the chapter entitled "Getting There First: An Evolutionary Rate Advantage for Adaptive Loss-of-Function Mutations" looks at the likelihood of gain-of-function and loss-of-function mutations occurring in a given population and finds loss-of-function mutations to be more probable in general, both in theory and in practice. https://www.youtube.com/watch?v=hzD3hhvepK8&index=20&list...
|
|||||||||||||||||||||||
CRR Member (Idle past 2270 days) Posts: 579 From: Australia Joined: |
"Now when the isolated populations merge ..."
Maybe they won't interbreed, maybe they can't, but probably they can and will. You can tell your story, I'll tell mine.
|
|
|
Do Nothing Button
Copyright 2001-2023 by EvC Forum, All Rights Reserved
Version 4.2
Innovative software from Qwixotic © 2024