|
Register | Sign In |
|
QuickSearch
EvC Forum active members: 65 (9164 total) |
| |
ChatGPT | |
Total: 916,422 Year: 3,679/9,624 Month: 550/974 Week: 163/276 Day: 3/34 Hour: 0/0 |
Thread ▼ Details |
Junior Member (Idle past 5052 days) Posts: 1 From: Austin, TX, US Joined: |
Thread Info
|
|
|
Author | Topic: Problems with evolution? Submit your questions. | |||||||||||||||||||||||||||||||||||||||
Taq Member Posts: 10038 Joined: Member Rating: 5.3
|
How does the mutation or natural selection produce new information? Would you agree that the human genome and the chimp genome contain different information? Is this difference in information due to the difference in DNA sequence? If you answered yes to both then you must also agree that a change in DNA sequence due to a mutation is new information. If you answered no to either question then please explain.
Do you have an empirical example of a code or language that occurs naturally? The orbitals of atoms is a good example. Hydrogen, the simplest element, has the code 1s^1. Helium is 1s^2. Read more here. Everything made up of atoms or particles has a code.
|
|||||||||||||||||||||||||||||||||||||||
Taq Member Posts: 10038 Joined: Member Rating: 5.3
|
Thousands of years ago no one spoke french. Now there are millions of people who speak french. How could this happen? Who did the first french speaker talk to? Edited by Taq, : No reason given.
|
|||||||||||||||||||||||||||||||||||||||
Taq Member Posts: 10038 Joined: Member Rating: 5.3 |
Since we have someone touting their information detection skills, I was wondering if one of you could answer this question.
Which one of the following DNA sequences carries the most information, and why: 1) AATCGGTTATTAAACCGAAA 2) TTGAATACGGTATTGATTTTT Once you pick out the DNA sequence with the most information of the two, please show me what the sequence looks like once information has either been added or taken away from that sequence, and how you determined the loss and the gain in information. Thank you.
|
|||||||||||||||||||||||||||||||||||||||
Taq Member Posts: 10038 Joined: Member Rating: 5.3 |
Hi, Taq. It's a trick question: since neither contains a stop codon, both of them have infinite information content. Functional open reading frames only comprise 3% or so of the human genome, yet IDer's claim that the entire genome contains information.
|
|||||||||||||||||||||||||||||||||||||||
Taq Member Posts: 10038 Joined: Member Rating: 5.3 |
The evolution of a new beta-galactosidase in E. coli
The EBG system of E. coli: origin and evolution of a novel beta-galactosidase for the metabolism of lactose - PubMed 8 left
|
|||||||||||||||||||||||||||||||||||||||
Taq Member Posts: 10038 Joined: Member Rating: 5.3 |
There are just some things science will not be able to solve. The intricate initial cells to what we have today, I accept came from some form of evolution. However I do not see how science can find the beginning of a naturally cause life. Evolution is not meant to answer questions as to the origin of life, only the origin of biodiversity. This would be a problem for Abiogenesis, not Evolution (per the title of the thread). Furthermore, the answer to the question of how the translation system came about may very well be answered by research into the RNA World hypothesis. Proteins are produced by RNA (ribosomal RNA) from RNA (mRNA) using RNA (tRNA). Therefore, RNA can be both a genetic molecule and an enzyme.
But one at some point must logically look at all the circumstantial evidence and form an opinion. My opinion and belief is that God created life. So what is the positive evidence that you used to conclude that God made the first life?
|
|||||||||||||||||||||||||||||||||||||||
Taq Member Posts: 10038 Joined: Member Rating: 5.3 |
There are some things that do not have natural models. How does a lack of a known natural mechanism indicate that the supernatural was responsible?
|
|||||||||||||||||||||||||||||||||||||||
Taq Member Posts: 10038 Joined: Member Rating: 5.3 |
Well if there is no natural mechanism and something exists, can one not consider a supernatural? How do you determine if there is no natural mechanism? We would have to have complete knowledge of nature to determine this, wouldn't we? Last I checked, we do not have this level of knowledge yet.
I see on this board a resistance to think about philsophy or any other discplines other than natural science. There are other ways to solve problems and reach conclusions besides science. Our resistance is to bad philosophy, such as the God-of-the-Gaps philosophy that you are pushing. You seem to think that the best place to find God is in our ignorance. That doesn't seem very inspiring to me. As to "other ways to solve a problem", when has a supernatural explanation ever turned out to be right? It would seem to me that science has found non-supernatural explanations for thousands of things that used to be credited to the supernatural. Why shouldn't we expect this trend to continue?
|
|||||||||||||||||||||||||||||||||||||||
Taq Member Posts: 10038 Joined: Member Rating: 5.3 |
The problem is you belileve science is the answer to everything. We know that science has found millions of answers that once alluded us (or were once credited to supernatural magic). It is science's track record that convinces us that it is worth using. Compare that to the abject failure of the thousands of years of supernaturalism in explaining nature prior to the advent of the modern scientific method.
|
|||||||||||||||||||||||||||||||||||||||
Taq Member Posts: 10038 Joined: Member Rating: 5.3 |
All four decided that the paper met the journal's editorial standards, Dr. Judd added, even though 'THERE WAS NO MECHANISM BY WHICH WE COULD UNDERSTAND THE RESULTS.' The difference here is that the authors were able to make predictions of experimental results based on their hypothesis, even if they are lacking a specific mechanism. IOW, they were able to test their hypothesis which is an important step in the scientific method. There is no testing of hypotheses in creationism. Creationism is a belief that is not challenged. Creationism is a dogmatic religious belief, not a scientifically testable hypothesis. If the authors of the aforementioned paper were to copy the creationist method then they would cite the lack of a known mechanism as evidence that Leprechauns travel back in time and then whisper the secrets of the future in the subject's ear.
I'll stand on my conclusion that God created the universe and all we know is a scientific conclusion. Dogmatic religious beliefs are not scientific conclusions.
|
|||||||||||||||||||||||||||||||||||||||
Taq Member Posts: 10038 Joined: Member Rating: 5.3 |
Classifications are a human creation and they really tell us nothing about facts. Linnaean taxonomy is certain a human creation that can be arbitrary at times. Where to draw the line between genera and family is certainly an arbitrary decision. However, the nested hierarchy is a fact, a fact that evolution predicts we should see. ID/creationism does not make this prediction. The theory of evolution predicts which mixtures of characteristics we should and should not see in both living and fossil species. This is how you test the theory. We should see species with a mixture of reptilian and mammalian features, but we should NOT see a mixture of avian and mammalian features. Therefore, an animal that has mammary glands and lays leathery eggs like the platypus is consistent with evolution while a bird with mammary glands and three middle ear bones would not. A majory violation of the nested hierarchy would be obvious to everyone, and it would be allowable for ID/creationism. So why don't we see any?
|
|||||||||||||||||||||||||||||||||||||||
Taq Member Posts: 10038 Joined: Member Rating: 5.3 |
I have my faith you have yours.
Projection is not an argument. We have the evidence.
|
|||||||||||||||||||||||||||||||||||||||
Taq Member Posts: 10038 Joined: Member Rating: 5.3 |
Darwin said a feature that could not exisit through a series of small changes. Behe coined "ireducible complexity" to falsify under these terms. Behe never demonstrated that IC systems could not evolve. In fact, IC systems were predicted to be a product of evolution in 1918:
quote:
|
|||||||||||||||||||||||||||||||||||||||
Taq Member Posts: 10038 Joined: Member Rating: 5.3
|
How many generations does it take for a cow to change into something else? It will never happen. You don't evolve out of your ancestry. In the tree of life you are always a part of the branch you came from. You never clip yourself off from a branch and attach somewhere else. What can happen is that the biodiversity of cows can increase, and perhaps even new species of cow will evolve. Think of all the dog breeds that have emerged from their wolf ancestors and how the wolf is still a dog as are all of the dog breeds. Edited by Taq, : No reason given.
|
|||||||||||||||||||||||||||||||||||||||
Taq Member Posts: 10038 Joined: Member Rating: 5.3 |
Major being the most important word here. We dont find mermaids or pegasus and this is somehow evidence for evolution. Funny how that works. A theory makes predictions and then those predictions turn out to be true. Usually, people consider this to be validation of the theory, at least those who do not have a religious beef against the theory.
When examples are found it is chalked up to the catch all of convergance. Examples?
Man made things can also be "nested" Does not prove they evolved. Actually, no they can't. This is one of the hallmarks of design, the lack of a nested hierarchy. Designers are free to mix and match different design units as they see fit. In fact, humans have designed organisms that clearly violate the nested hierarchy.
|
|
|
Do Nothing Button
Copyright 2001-2023 by EvC Forum, All Rights Reserved
Version 4.2
Innovative software from Qwixotic © 2024