Problems with evolution? Submit your questions.

Would you agree that the human genome and the chimp genome contain different information? Is this difference in information due to the difference in DNA sequence? If you answered yes to both then you must also agree that a change in DNA sequence due to a mutation is new information. If you answered no to either question then please explain. The orbitals of atoms is a good example. Hydrogen, the simplest element, has the code 1s^1. Helium is 1s^2. Read more here. Everything made up of atoms or particles has a code.

so the seed came first and it grew from a plant which grew from a spore! ​ That makes no sense at all. If the seed grows from a plant, then the plant came first ​ then again, the plant came from a spore so the spore came first....hence a spore produced a plant which produced seed. ​ So that takes us to the spore..... how did the spore evolve and from what?

Thousands of years ago no one spoke french. Now there are millions of people who speak french. How could this happen? Who did the first french speaker talk to?Edited by Taq, : No reason given.

Since we have someone touting their information detection skills, I was wondering if one of you could answer this question.Which one of the following DNA sequences carries the most information, and why:1) AATCGGTTATTAAACCGAAA2) TTGAATACGGTATTGATTTTTOnce you pick out the DNA sequence with the most information of the two, please show me what the sequence looks like once information has either been added or taken away from that sequence, and how you determined the loss and the gain in information.Thank you.

Functional open reading frames only comprise 3% or so of the human genome, yet IDer's claim that the entire genome contains information.

The evolution of a new beta-galactosidase in E. coliThe EBG system of E. coli: origin and evolution of a novel beta-galactosidase for the metabolism of lactose - PubMed8 left

Evolution is not meant to answer questions as to the origin of life, only the origin of biodiversity. This would be a problem for Abiogenesis, not Evolution (per the title of the thread).Furthermore, the answer to the question of how the translation system came about may very well be answered by research into the RNA World hypothesis. Proteins are produced by RNA (ribosomal RNA) from RNA (mRNA) using RNA (tRNA). Therefore, RNA can be both a genetic molecule and an enzyme. So what is the positive evidence that you used to conclude that God made the first life?

How does a lack of a known natural mechanism indicate that the supernatural was responsible?

How do you determine if there is no natural mechanism? We would have to have complete knowledge of nature to determine this, wouldn't we? Last I checked, we do not have this level of knowledge yet. Our resistance is to bad philosophy, such as the God-of-the-Gaps philosophy that you are pushing. You seem to think that the best place to find God is in our ignorance. That doesn't seem very inspiring to me.As to "other ways to solve a problem", when has a supernatural explanation ever turned out to be right? It would seem to me that science has found non-supernatural explanations for thousands of things that used to be credited to the supernatural. Why shouldn't we expect this trend to continue?

We know that science has found millions of answers that once alluded us (or were once credited to supernatural magic). It is science's track record that convinces us that it is worth using. Compare that to the abject failure of the thousands of years of supernaturalism in explaining nature prior to the advent of the modern scientific method.

The difference here is that the authors were able to make predictions of experimental results based on their hypothesis, even if they are lacking a specific mechanism. IOW, they were able to test their hypothesis which is an important step in the scientific method.There is no testing of hypotheses in creationism. Creationism is a belief that is not challenged. Creationism is a dogmatic religious belief, not a scientifically testable hypothesis.If the authors of the aforementioned paper were to copy the creationist method then they would cite the lack of a known mechanism as evidence that Leprechauns travel back in time and then whisper the secrets of the future in the subject's ear. Dogmatic religious beliefs are not scientific conclusions.

Linnaean taxonomy is certain a human creation that can be arbitrary at times. Where to draw the line between genera and family is certainly an arbitrary decision. However, the nested hierarchy is a fact, a fact that evolution predicts we should see. ID/creationism does not make this prediction.The theory of evolution predicts which mixtures of characteristics we should and should not see in both living and fossil species. This is how you test the theory. We should see species with a mixture of reptilian and mammalian features, but we should NOT see a mixture of avian and mammalian features. Therefore, an animal that has mammary glands and lays leathery eggs like the platypus is consistent with evolution while a bird with mammary glands and three middle ear bones would not.A majory violation of the nested hierarchy would be obvious to everyone, and it would be allowable for ID/creationism. So why don't we see any?

Projection is not an argument. We have the evidence.

Behe never demonstrated that IC systems could not evolve. In fact, IC systems were predicted to be a product of evolution in 1918:

quote:

---

. . . thus a complicated machine was gradually built up whose effective working was dependent upon the interlocking action of very numerous different elementary parts or factors, and many of the characters and factors which, when new, were originally merely an asset finally became necessary because other necessary characters and factors had subsequently become changed so as to be dependent on the former. It must result, in consequence, that a dropping out of, or even a slight change in any one of these parts is very likely to disturb fatally the whole machinery; for this reason we should expect very many, if not most, mutations to result in lethal factors ..."
Muller 1918 pp. 463-464.
Muller, H. J. (1918) "Genetic variability, twin hybrids and constant hybrids, in a case of balanced lethal factors." Genetics 3:422-499.

---

It will never happen. You don't evolve out of your ancestry. In the tree of life you are always a part of the branch you came from. You never clip yourself off from a branch and attach somewhere else. What can happen is that the biodiversity of cows can increase, and perhaps even new species of cow will evolve. Think of all the dog breeds that have emerged from their wolf ancestors and how the wolf is still a dog as are all of the dog breeds.Edited by Taq, : No reason given.

Funny how that works. A theory makes predictions and then those predictions turn out to be true. Usually, people consider this to be validation of the theory, at least those who do not have a religious beef against the theory. Examples? Actually, no they can't. This is one of the hallmarks of design, the lack of a nested hierarchy. Designers are free to mix and match different design units as they see fit. In fact, humans have designed organisms that clearly violate the nested hierarchy.