Understanding through Discussion


Welcome! You are not logged in. [ Login ]
EvC Forum active members: 113 (8748 total)
Current session began: 
Page Loaded: 05-23-2017 4:58 AM
403 online now:
CosmicChimp, PaulK, vimesey (3 members, 400 visitors)
Chatting now:  Chat room empty
Newest Member: kmastes01
Post Volume:
Total: 808,845 Year: 13,451/21,208 Month: 2,933/3,605 Week: 275/933 Day: 17/154 Hour: 0/1

Announcements: Reporting debate problems OR discussing moderation actions/inactions


Thread  Details

Email This Thread
Newer Topic | Older Topic
  
RewPrev1
...
5859
60
6162
...
65Next
Author Topic:   Why is evolution so controversial?
zaius137
Member (Idle past 818 days)
Posts: 407
Joined: 05-08-2012


Message 886 of 969 (740575)
11-05-2014 11:06 PM


The end of evolution
Just for one minute, step back and take a overall picture.

Do you see what is driving these large divergence times? The big deal is the rate of mutation… Indels rate of occurrence is slower than that of substitutions. Also the relevance of indels to human chimp divergence is only growing with new research.

This is that “perfect storm” I mentioned way back in the posts.

Regardless if you say I am misusing Nachman and Crowell’s paper. The trend is that Paleoanthropology and genetics are becoming more discordant with time. This is not supposed to happen with a healthy theory. It is evolution in decline.


Replies to this message:
 Message 888 by Taq, posted 11-06-2014 12:07 AM zaius137 has not yet responded
 Message 891 by Dr Adequate, posted 11-06-2014 12:20 AM zaius137 has not yet responded

  
Taq
Member
Posts: 6409
Joined: 03-06-2009
Member Rating: 4.4


Message 887 of 969 (740576)
11-06-2014 12:03 AM
Reply to: Message 884 by zaius137
11-05-2014 10:17 PM


Re: Any real evidence for evolution, point on point.
I am sure this is accurate for what genes this paper looked at. These numbers do vary from paper to paper according to the focus of the researchers.

They looked at over 90% of the chimp genome, including the non-coding DNA. Their sequencing covered about 95% of the genome, if memory serves. Genes only make up about 3% of the genome.

The chimp genome paper is the definitive paper for comparing the chimp genome to the human genome. Any subsequent papers will only be covering the 10% that they were not able to align with the human genome, or haplotypes within the chimp genome.

would say you can not get to 5% from 1.33% in these results. Like I say, different findings for different genes investigated.

Here is a paper comparing different genes ( it covered exclusively chromosome 21 in humans and chromosome 22 in chimps) “high-quality BAC clone sequences of the homologous chimpanzee chromosome 22” quote.

I don't think you have a grasp of how much the chimp genome paper covered.

"The draft genome assembly—generated from ~3.6-fold sequence redundancy of the autosomes and ~1.8-fold redundancy of both sex chromosomes—covers ~94% of the chimpanzee genome with >98% of the sequence in high-quality bases. "
http://www.nature.com/...al/v437/n7055/full/nature04072.html

Look at Table 1. They covered 2.7 billion bases.

http://www.nature.com/...7/n7055/fig_tab/nature04072_T1.html

They didn't look at a handful of genes or just a couple chromosomes. They sequenced nearly the entire genome and then compared it to the draft human genome which is even more complete than the chimp genome.

As I have stated over and over… indel and substitution rates are addable/

As I stated earlier, they can only be added if they have the same units.

Edited by Taq, : No reason given.


This message is a reply to:
 Message 884 by zaius137, posted 11-05-2014 10:17 PM zaius137 has responded

Replies to this message:
 Message 890 by sfs, posted 11-06-2014 12:10 AM Taq has responded
 Message 894 by zaius137, posted 11-06-2014 12:20 PM Taq has responded

  
Taq
Member
Posts: 6409
Joined: 03-06-2009
Member Rating: 4.4


Message 888 of 969 (740577)
11-06-2014 12:07 AM
Reply to: Message 886 by zaius137
11-05-2014 11:06 PM


Re: The end of evolution
The big deal is the rate of mutation… Indels rate of occurrence is slower than that of substitutions. Also the relevance of indels to human chimp divergence is only growing with new research.

The rate of mutation is not the same as the rate of bases changed. That's what you keep forgetting. Scientists have understood the relevance of indels for the entire time. No one is ignoring them, and no one has been ignoring them.

The trend is that Paleoanthropology and genetics are becoming more discordant with time.

References?


This message is a reply to:
 Message 886 by zaius137, posted 11-05-2014 11:06 PM zaius137 has not yet responded

  
sfs
Member
Posts: 464
From: Cambridge, MA USA
Joined: 08-27-2003


Message 889 of 969 (740578)
11-06-2014 12:07 AM
Reply to: Message 884 by zaius137
11-05-2014 10:17 PM


Re: Any real evidence for evolution, point on point.
quote:

I am sure this is accurate for what genes this paper looked at. These numbers do vary from paper to paper according to the focus of the researchers.


Which part of "largely complete" did you not understand? The paper looked at (nearly) the entire genome.
quote:

I agree for the gene segments analyzed.


Which was nearly all of them.
quote:

I would say you can not get to 5% from 1.33% in these results. Like I say, different findings for different genes investigated.


Of course you can get to 5% -- provided you account for the size of the indels. But you've only been told that 10 or 20 times now, so I'm sure you're not going to understand it yet. In fact, this paper does say the difference is 5%. (Well, actually it says something more accurate than that, but let's try to stick to the simplest story here.) And no, it's not because of the genes that were investigated. (In fact, genes constitute only a tiny fraction of the genomes being compared.)
quote:

Here is a shameless repost of the calculation I did with only using indel variables from the proceeding paper and reduced mutation rate for indels.


Incorrect calculations don't become correct by repeating them.
quote:

As I have stated over and over… indel and substitution rates are addable. They both reflect “autosomal sequence divergence” for the (k) in the calculation in question.


And as people who know far more about the subject than you do have replied over and over, you're wrong.

I do wonder about the source of this idea that anybody's interpretation of a scientific paper is a valid as anybody else's. I wonder if some kind of misbegotten offspring of the protestant doctrine that everyone should be able to read and interpret scripture for themselves. I dunno. In any case, you're claiming to understand these papers better than their authors, which is kind of silly.


This message is a reply to:
 Message 884 by zaius137, posted 11-05-2014 10:17 PM zaius137 has not yet responded

    
sfs
Member
Posts: 464
From: Cambridge, MA USA
Joined: 08-27-2003


Message 890 of 969 (740579)
11-06-2014 12:10 AM
Reply to: Message 887 by Taq
11-06-2014 12:03 AM


Re: Any real evidence for evolution, point on point.
quote:
Genes only make up about 3% of the genome.

In particular, the coding sequence of genes makes up less than 2% of the genome.
This message is a reply to:
 Message 887 by Taq, posted 11-06-2014 12:03 AM Taq has responded

Replies to this message:
 Message 893 by Taq, posted 11-06-2014 12:43 AM sfs has not yet responded

    
Dr Adequate
Member
Posts: 15927
Joined: 07-20-2006
Member Rating: 3.8


Message 891 of 969 (740580)
11-06-2014 12:20 AM
Reply to: Message 886 by zaius137
11-05-2014 11:06 PM


Re: The end of evolution
The trend is that Paleoanthropology and genetics are becoming more discordant with time.

But since this is only happening in your head, it doesn't have the significance you wish to place on it.


This message is a reply to:
 Message 886 by zaius137, posted 11-05-2014 11:06 PM zaius137 has not yet responded

  
Taq
Member
Posts: 6409
Joined: 03-06-2009
Member Rating: 4.4


(1)
Message 892 of 969 (740582)
11-06-2014 12:38 AM
Reply to: Message 885 by zaius137
11-05-2014 10:31 PM


One more attempt
Just what I was looking for…. thanks.

With that in mind, let's see if this example sticks this time. Here are two sequences that differ by 1 indel.


seq A: AGTGTCT_____ACTATCCT
seq B: AGTGTCTCCCCCACTATCCT

The sequences differ by 5 bases. That is a 25% nucleotide difference out of the 20 bases in seq B. However, there is only 1 mutation, so the difference by number of mutations is 5% (if we count 1 mutation in 20 bases). Although sfs will probably correct me and point out that 5% is not technically correct, it should give you a feel for the difference between number of bases and number of mutations.


This message is a reply to:
 Message 885 by zaius137, posted 11-05-2014 10:31 PM zaius137 has not yet responded

  
Taq
Member
Posts: 6409
Joined: 03-06-2009
Member Rating: 4.4


(1)
Message 893 of 969 (740583)
11-06-2014 12:43 AM
Reply to: Message 890 by sfs
11-06-2014 12:10 AM


Re: Any real evidence for evolution, point on point.
In particular, the coding sequence of genes makes up less than 2% of the genome.

I would even be wiling to add in RNA genes, upstream regulatory elements, and splicing sites. I could even be talked into 5% or even 10% of the genome that is under negative selection if we consider genes to be heritable units that factor into fitness.

However, to come away with the impression that the chimp genome paper only covered a few genes . . . well, that's a bird of a different color. Luckily, zaius is here to clear up any misunderstandings you have about genetics.

Edited by Taq, : No reason given.


This message is a reply to:
 Message 890 by sfs, posted 11-06-2014 12:10 AM sfs has not yet responded

Replies to this message:
 Message 896 by zaius137, posted 11-06-2014 12:32 PM Taq has responded

  
zaius137
Member (Idle past 818 days)
Posts: 407
Joined: 05-08-2012


Message 894 of 969 (740624)
11-06-2014 12:20 PM
Reply to: Message 887 by Taq
11-06-2014 12:03 AM


Re: Any real evidence for evolution, point on point.
quote:
They looked at over 90% of the chimp genome, including the non-coding DNA. Their sequencing covered about 95% of the genome, if memory serves. Genes only make up about 3% of the genome.
The chimp genome paper is the definitive paper for comparing the chimp genome to the human genome. Any subsequent papers will only be covering the 10% that they were not able to align with the human genome, or haplotypes within the chimp genome.

Look my friend not all the differences they found ended up in the percentage of autosomal variance. If they counted all divergence, humans and chimps would have a similarity less than 70%. About 700 million base pair did not even align at that time (that is .7/6.2 or about 11% of the two genomes).

I have no problems with the findings except the same old 1.5% divergence (that is an interpretation). Face the fact that interpretive comparisons are a bit more than a cherry pick (especially this one). Let us talk about papers written after the initial sequencing back in 2005 for further new and hopefully more objective interpretation.

quote:
I don't think you have a grasp of how much the chimp genome paper covered.
"The draft genome assembly—generated from ~3.6-fold sequence redundancy of the autosomes and ~1.8-fold redundancy of both sex chromosomes—covers ~94% of the chimpanzee genome with >98% of the sequence in high-quality bases. "
http://www.nature.com/...al/v437/n7055/full/nature04072.html
Look at Table 1. They covered 2.7 billion bases.
http://www.nature.com/...7/n7055/fig_tab/nature04072_T1.html
They didn't look at a handful of genes or just a couple chromosomes. They sequenced nearly the entire genome and then compared it to the draft human genome which is even more complete than the chimp genome.

So you will accept the initial sequencing interpretation over all subsequent papers? Sorry I do not…

quote:
As I stated earlier, they can only be added if they have the same units.

And indels do… the difference in “mutations per site”.

(divergence in) Mutaions per site (k)/ mutations per site per generation (u) = generations… t=.5(k/u-4Ne) which gives t the units of generation.

Your argument is moot.


This message is a reply to:
 Message 887 by Taq, posted 11-06-2014 12:03 AM Taq has responded

Replies to this message:
 Message 895 by Dr Adequate, posted 11-06-2014 12:29 PM zaius137 has responded
 Message 897 by Taq, posted 11-06-2014 12:34 PM zaius137 has responded

  
Dr Adequate
Member
Posts: 15927
Joined: 07-20-2006
Member Rating: 3.8


(1)
Message 895 of 969 (740625)
11-06-2014 12:29 PM
Reply to: Message 894 by zaius137
11-06-2014 12:20 PM


Re: Any real evidence for evolution, point on point.
The number of mutations, and the number of divergent bases, are not the same numbers.

This has been explained to you, and explained to you, and explained to you, and explained to you, and explained to you, and explained to you, and explained to you, and explained to you, and explained to you, and explained to you, and explained to you, and explained to you, and explained to you, and explained to you, and explained to you, and explained to you, and explained to you, and explained to you, and explained to you, and explained to you, and explained to you, and explained to you, and explained to you, and explained to you, and explained to you, and explained to you, and explained to you, and explained to you, and explained to you, and explained to you, and explained to you, and explained to you, and explained to you, and explained to you, and explained to you, and explained to you, and explained to you, and explained to you, and explained to you, and explained to you, and explained to you, and explained to you, and explained to you, and explained to you, and explained to you, and explained to you, and explained to you, and explained to you, and explained to you, and explained to you, and explained to you, and explained to you, and explained to you, and explained to you, and explained to you, and explained to you, and explained to you, and explained to you, and explained to you, and explained to you, and explained to you, and explained to you, and explained to you, and explained to you, and explained to you, and explained to you, and explained to you, and explained to you, and explained to you.


This message is a reply to:
 Message 894 by zaius137, posted 11-06-2014 12:20 PM zaius137 has responded

Replies to this message:
 Message 898 by zaius137, posted 11-06-2014 12:35 PM Dr Adequate has responded

  
zaius137
Member (Idle past 818 days)
Posts: 407
Joined: 05-08-2012


Message 896 of 969 (740627)
11-06-2014 12:32 PM
Reply to: Message 893 by Taq
11-06-2014 12:43 AM


Re: Any real evidence for evolution, point on point.
quote:
With that in mind, let's see if this example sticks this time. Here are two sequences that differ by 1 indel.

seq A: AGTGTCT_____ACTATCCT
seq B: AGTGTCTCCCCCACTATCCT
The sequences differ by 5 bases. That is a 25% nucleotide difference out of the 20 bases in seq B. However, there is only 1 mutation, so the difference by number of mutations is 5% (if we count 1 mutation in 20 bases). Although sfs will probably correct me and point out that 5% is not technically correct, it should give you a feel for the difference between number of bases and number of mutations.


Good… count of mutations is (1) this gives (1) mutation per site. (k) = number of mutations “different” between species / number of sites…

In this case:

Number of mutations = 1

Number of sites = 1

1/1 = 100% in this case.

Now given 2 sites...

Given 2 sites with 1 mutation.

Number of mutations = 1

number of sites =2

percent divergence = 1/2 or 50%.

Get it, Got it… Mutations per site…..


This message is a reply to:
 Message 893 by Taq, posted 11-06-2014 12:43 AM Taq has responded

Replies to this message:
 Message 899 by Taq, posted 11-06-2014 12:35 PM zaius137 has responded

  
Taq
Member
Posts: 6409
Joined: 03-06-2009
Member Rating: 4.4


Message 897 of 969 (740629)
11-06-2014 12:34 PM
Reply to: Message 894 by zaius137
11-06-2014 12:20 PM


Re: Any real evidence for evolution, point on point.
Look my friend not all the differences they found ended up in the percentage of autosomal variance. If they counted all divergence, humans and chimps would have a similarity less than 70%. About 700 million base pair did not even align at that time (that is .7/6.2 or about 11% of the two genomes).

sfs can explain it much better than I can, but "not aligning" is not a synonym for "0% homology". If you don't know where the sequence fits in the chimp genome then you can't even compare it to the human genome to begin with. Therefore, you have no evidence that the unaligned sequence would have 0% homology. Even random sequence will have 25% homology.

I have no problems with the findings except the same old 1.5% divergence (that is an interpretation). Face the fact that interpretive comparisons are a bit more than a cherry pick (especially this one). Let us talk about papers written after the initial sequencing back in 2005 for further new and hopefully more objective interpretation.

Any paper after 2005 will also be interpretations. Unless you can show us how the reported sequence in the 2005 paper is wrong, I don't see what objection you really have. They sequenced 94% of the genome. Do you really think the other 6% is going to be strikingly different?

And indels do… the difference in “mutations per site”.

The 5% number you keep using is in "bases changed". Therfore, they are not in the same units.


This message is a reply to:
 Message 894 by zaius137, posted 11-06-2014 12:20 PM zaius137 has responded

Replies to this message:
 Message 901 by zaius137, posted 11-06-2014 1:01 PM Taq has responded

  
zaius137
Member (Idle past 818 days)
Posts: 407
Joined: 05-08-2012


Message 898 of 969 (740630)
11-06-2014 12:35 PM
Reply to: Message 895 by Dr Adequate
11-06-2014 12:29 PM


Re: Any real evidence for evolution, point on point.
Good post... Too early for cheers.

Well maybe not in your case... Cheers!


This message is a reply to:
 Message 895 by Dr Adequate, posted 11-06-2014 12:29 PM Dr Adequate has responded

Replies to this message:
 Message 900 by Dr Adequate, posted 11-06-2014 12:42 PM zaius137 has not yet responded

  
Taq
Member
Posts: 6409
Joined: 03-06-2009
Member Rating: 4.4


Message 899 of 969 (740631)
11-06-2014 12:35 PM
Reply to: Message 896 by zaius137
11-06-2014 12:32 PM


Re: Any real evidence for evolution, point on point.
In this case:

Number of mutations = 1

Number of sites = 1

In seq B there are 20 sites. Perhaps you want to try that again?


This message is a reply to:
 Message 896 by zaius137, posted 11-06-2014 12:32 PM zaius137 has responded

Replies to this message:
 Message 902 by zaius137, posted 11-06-2014 1:04 PM Taq has responded

  
Dr Adequate
Member
Posts: 15927
Joined: 07-20-2006
Member Rating: 3.8


(1)
Message 900 of 969 (740633)
11-06-2014 12:42 PM
Reply to: Message 898 by zaius137
11-06-2014 12:35 PM


Re: Any real evidence for evolution, point on point.
Good post... Too early for cheers.
Well maybe not in your case... Cheers!

Thank you. So will you promise not to write anything so mindbogglingly stupid as this:

(divergence in) Mutaions per site (k)

... ever, ever again?


This message is a reply to:
 Message 898 by zaius137, posted 11-06-2014 12:35 PM zaius137 has not yet responded

  
RewPrev1
...
5859
60
6162
...
65Next
Newer Topic | Older Topic
Jump to:


Copyright 2001-2015 by EvC Forum, All Rights Reserved

™ Version 4.0 Beta
Innovative software from Qwixotic © 2017