Message 1 of 161 (809971) 05-22-2017 12:55 PM

Show us a single genetic difference between the human and chimp genome that could not have been produced by known microevolutionary processes in either the chimp or human lineages.

Just for clarity, I am defining a microevolutionary change as a single mutational event (e.g. base substitution, insertion, deletion, transposon insertion, retroviral insertion, or genetic recombination) that is passed on to descendants.

As an example, here is a comparison of portion of the human HNF1 homeobox A gene and the homologous chimp gene:

Query  1     GGCCCTGTGGCAGCCGAGCCATGGTTTCTAAACTGAGCCAGCTGCAGACGGAGCTCCTGG  60
             ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct  1100  GGCCCTGTGGCAGCCGAGCCATGGTTTCTAAACTGAGCCAGCTGCAGACGGAGCTCCTGG  1159
Query  61    CGGCCCTGCTGGAGTCAGGGCTGAGCAAAGAGGCACTGCTCCAGGCACTGGGTGAGCCGG  120
             |||||||||| ||||||||||||||||||||||||||| |||||||||||||||||||||
Sbjct  1160  CGGCCCTGCTCGAGTCAGGGCTGAGCAAAGAGGCACTGATCCAGGCACTGGGTGAGCCGG  1219
Query  121   GGCCCTACCTCCTGGCTGGAGAAGGCCCCCTGGACAAGGGGGAGTCCTGCGGCGGCGGTC  180
             ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct  1220  GGCCCTACCTCCTGGCTGGAGAAGGCCCCCTGGACAAGGGGGAGTCCTGCGGCGGCGGTC  1279

The human sequence is on top, and the chimp sequence is on the bottom. The "|" symbols indicate where the two sequences are the same. As you can see, there are two base substitutions in the middle row.

Can any creationist give us a single reason why two microevolutionary events could not produce those two base differences? Can creationists point to any different in the chimp and human genomes that could not be produced microevolution?

To admin: Would prefer placement in the Biological Evolution forum.

Edited by Taq, : No reason given.

Edited by Taq, : No reason given.

Message 3 of 161 (809974) 05-22-2017 2:24 PM

Reply to: Message 1 by Taq 05-22-2017 12:55 PM

But that didn't produce a new 'kind' ... oh wait ...

Message 4 of 161 (810117) 05-23-2017 4:59 PM

As it turns out, the first mutation in the opening post is specific to the chimp lineage, and the second mutation is specific to the human lineage (using BLASTn).

Message 5 of 161 (810143) 05-24-2017 7:54 AM

Reply to: Message 4 by Taq 05-23-2017 4:59 PM

Nicely done.

Are you sure about those time stamps at the bottom? I thought human/chimp split was ~10MYA, and this puts the split square in the lap of Ardipithecus ramidus and Ardipithecus kadabba:

quote:

---

Ardipithecus is a genus of an extinct hominine that lived during Late Miocene and Early Pliocene in Afar Depression, Ethiopia. Originally described as one of the earliest ancestors of humans after they diverged from the main ape lineage, the relation of this genus to human ancestors and whether it is a hominin is now a matter of debate.[1] Two fossil species are described in the literature: A. ramidus, which lived about 4.4 million years ago[2] during the early Pliocene, and A. kadabba, dated to approximately 5.6 million years ago (late Miocene).[3] Behavioral analysis showed that Ardipithecus could be very similar to chimpanzees, indicating that the early human ancestors were very chimpanzee-like in behaviour.[1]

---

and it puts the gorilla split in the lap of Sahelanthropus tchadensis:

quote:

---

Sahelanthropus tchadensis is an extinct homininae species (and is probably the ancestor to Orrorin) that is dated to about 7 million years ago, during the Miocene epoch, possibly very close to the time of the chimpanzee–human divergence. Few specimens are known, other than the partial skull nicknamed Toumaï ("hope of life").

---

Exciting times.

Enjoy

Message 6 of 161 (810160) 05-24-2017 10:52 AM

Reply to: Message 5 by RAZD 05-24-2017 7:54 AM

A quick scan of a Google Scholar search seems to show that recent papers are still using divergence times of around 4-6 million years, with some papers going even as high as 8 MYA. I would suspect that 10 MYA would be an outlier with respect to the consensus.

As to Ardipithecus, it may push the common ancestor more towards the 6 MYA side of the equation than the 4 MYA.

Message 7 of 161 (810170) 05-24-2017 2:57 PM

Reply to: Message 6 by Taq 05-24-2017 10:52 AM

Or it is just old. I remember speculating when Sahelanthropus tchadensis was found that it could be the common ancestor with chimps.

Or it (or a close relative) is the common ancestor.

We know already that it is intermediate in form and that "Behavioral analysis showed that Ardipithecus could be very similar to chimpanzees, indicating that the early human ancestors were very chimpanzee-like in behaviour.[1]"

See The story of Bones and Dogs and Humans:

quote:

---

Let's put Ardi in a line-up with Humans, Australopithicus and Chimps (note skeletons not scaled the same):

---

The major difference in appearance I see being the hip bones, but not out of a reasonable realm for evolution.

There are some missing bones for the Ardi reconstruction, so new finds will be needed to fill in that gap in our knowledge.

Enjoy

Message 8 of 161 (810171) 05-24-2017 4:30 PM

Reply to: Message 7 by RAZD 05-24-2017 2:57 PM

Could be.

For the time being, however, the actual dates are somewhat irrelevant. What matters for the gorilla/chimp/human triad is that the chimp/human lineage diverged from the gorilla lineage followed by humans and chimps diverging into their own lineages. This is what allows us to model the common ancestral genome and assign mutations to either the human or chimp lineage. Of course, incomplete lineage sorting can cause some inconsistencies, but for now we are going to go with a simple model.

Message 9 of 161 (810187) 05-25-2017 12:12 AM

Reply to: Message 1 by Taq 05-22-2017 12:55 PM

Why not first start a thread on the definitions and differences between microevolution and macroevolution?

Message 10 of 161 (810193) 05-25-2017 6:28 AM

Reply to: Message 9 by CRR 05-25-2017 12:12 AM

Several threads on this issue, see MACROevolution vs MICROevolution - what is it? for example. It starts with creationist misinformed definitions.

Enjoy

Message 11 of 161 (810206) 05-25-2017 11:00 AM

Reply to: Message 9 by CRR 05-25-2017 12:12 AM

The bounds are the chimp and human genomes. What I am asking is if humans and chimps share a common ancestor, which genetic differences between them are you saying couldn't be produced by the observed mechanisms of mutagenesis.

mutagenesis = production of mutations

The major types of mutations are substitutions, insertions, deletions, transposon or retroviral insertion, and genetic recombination. A google search for those terms should give you all the definitions and descriptions that you need. If you have questions, please ask.

Microevolution occurs when a single mutation is passed on to subsequent generations and either increases or decreases in frequency over multiple generations.

Macroevolution occurs when two separate populations do not freely interbreed causing different microevolutionary events to accumulate in each of populations. This causes the populations to become different from one another over time, as is the case for humans and chimps.

Creationists claim that microevolutionary events can not accumulate to the point where they produce the genetic differences seen between separate species. I am using the human and chimp genomes as our specific example, and challenging creationists to point to a single genetic difference between the chimp and human genomes that could not be produced by a microevolutionary event. They must also explain what would stop mutations from accumulating over time since every generation is born with new mutations.

Message 12 of 161 (812337) 06-16-2017 4:19 AM

Reply to: Message 1 by Taq 05-22-2017 12:55 PM

That asked, the chances of the mutations required between human and primate, occurring in the right gene and often enough in the population to change the genome of the entire species, are next to naught.

By themselves, random base substitutions, and deletions, resulting in beneficial changes to the organism, do not occur frequently enough.

When the assumption was made in the 1930s that point mutations could be the cause of an organism's progress, they could not properly calculate the chances of that happening. We can forgive them, for this assumption.

We now know how tiny the odds are, and so can not be forgiven for making the same mistake.

As for genetic insertions and recombinations, while occurring fairly often, aren't random processes like mutations, but are functions inherent in the genome.

Doctor Shapiro states: "In the pre-DNA era, students were all taught that genetic change is random and accidental. Because the molecular details were inaccessible, this was the
default assumption. But once we learned about DNA carrying hereditary
information, we could research the
details of how changes occur. We no
longer needed to assume. We could
investigate."

As his article describes, genetic recombination is not at all random: http://m.huffpost.com/us/entry/1743647

Regards, aristotle

Edited by aristotle, : No reason given.

Message 13 of 161 (812340) 06-16-2017 4:34 AM

Reply to: Message 12 by aristotle 06-16-2017 4:19 AM

We don't expect creationists to be able to prove anything - our expections are very, very low based on prior observation.

But yes, if you could show that mutations do not contribute positively to the evolutionary process by using actual research - and not simply quote mining - that would be a very valuable addition to science.

Btw, it's always useful to know with a newbie creationist, how old do you think the earth is?

Message 14 of 161 (812352) 06-16-2017 6:24 AM

Reply to: Message 12 by aristotle 06-16-2017 4:19 AM

That's not quite what he asked in Message 1. He actually asked:

eg - compare the genomes and show which differences could not occur through mutations of the type observed in organisms today.

Do you see the difference?

Do you agree that domestic dogs and cats and cows and sheep show a wide variety of traits and sizes to the point where some dogs are remarkably different from other dogs?

That's a lot of genetic changes and a fair proportion of them are documented by historical observation in recent (geoplogical) years.

If we compared the skeletons of those dogs to one another, would we see more or less variation than see here:

Inquiring minds want to know.

Enjoy

Message 15 of 161 (812354) 06-16-2017 7:01 AM

Reply to: Message 13 by Tangle 06-16-2017 4:34 AM

So posting one quote is 'quote mining'?! Okay then

Btw, the quote was not about mutations, it was about recombinations

Again, I ask you how you can ask me to show that mutations were not the cause of our evolution, when you can't prove that they did?

I never asked you to prove that the mutations evolved us, you chose to be an Evolutionist, but then at least have the courtesy to try and prove your own assumptions, instead of just expecting others to disprove them.

Again you pigeonhole me as a creationist, it shows your extremely narrow view. I don't know how old the earth is, and I'm certainly not as arrogant as evolutionists to think that I know how life was created.

Regards, aristotle