TGTGACGTCTGACGTTGCGTAGTACGTACTGACTACGCTGAGTACGTACGTGA
TGTGACGTCTGACGTTGCGTAGTATGTACTGACTACGCTGAGTACGTACGTGA
Good morning godservant:
One of the above is a mutation of the other. Using your theory of “Mutations Only Cause a Lose of Information” can you sort out which one is the original? It should, after all, have more information.
Edited by lyx2no, : because I can.
Kindly
I've been off doing my bit to save the world, and it totally sucked.