Understanding through Discussion


Welcome! You are not logged in. [ Login ]
EvC Forum active members: 113 (8749 total)
Current session began: 
Page Loaded: 05-25-2017 10:29 AM
368 online now:
Coyote, DrJones*, dwise1, jar, PaulK, ramoss, RAZD, vimesey (8 members, 360 visitors)
Chatting now:  Chat room empty
Newest Member: Roshankumar1234
Post Volume:
Total: 808,997 Year: 13,603/21,208 Month: 3,085/3,605 Week: 427/933 Day: 16/56 Hour: 1/2

Announcements: Reporting debate problems OR discussing moderation actions/inactions


Thread  Details

Email This Thread
Newer Topic | Older Topic
  
RewPrev1
...
3940
41
4243
...
47Next
Author Topic:   How do you define the word Evolution?
Taq
Member
Posts: 6439
Joined: 03-06-2009
Member Rating: 4.3


Message 601 of 693 (807501)
05-03-2017 11:17 AM
Reply to: Message 590 by Dredge
05-03-2017 2:08 AM


Re: If Not, What?
Dredge writes:

Chicko gave them to me.

Assuming you are referring to Jack Chick, why in the world would you get your science information from religious tracts?


This message is a reply to:
 Message 590 by Dredge, posted 05-03-2017 2:08 AM Dredge has responded

Replies to this message:
 Message 612 by Dredge, posted 05-04-2017 6:27 AM Taq has not yet responded

  
Taq
Member
Posts: 6439
Joined: 03-06-2009
Member Rating: 4.3


Message 602 of 693 (807502)
05-03-2017 11:19 AM
Reply to: Message 589 by Dredge
05-03-2017 2:03 AM


Re: If Not, What?
Dredge writes:

Thank you for that very interesting information. But somewhere in the mix a human being contains more genetic information than an amoeba.

By what measure? How do you determine how much information is in a DNA sequence? For example:

ATTACCATGGTCCTAGAAGTTCGGCACAGTTAGTTCGAGCCTAATGTCACA
AATGACGCAGAACGCCAATGAGTGCCAGACATTAGGTGGAGTTCAGTTCG
GTAACGGAGAGACTCTGCGGCGTACTTAATTATGCATTTGAAACGCGCCCA
AGTGACGCTAGGCAAGTCAGAGCAGGTT CCCGTGTTAGCTTGAGGGTA

How much genetic information is in that sequence?

Edited by Taq, : No reason given.


This message is a reply to:
 Message 589 by Dredge, posted 05-03-2017 2:03 AM Dredge has responded

Replies to this message:
 Message 613 by Dredge, posted 05-04-2017 6:29 AM Taq has not yet responded

  
Taq
Member
Posts: 6439
Joined: 03-06-2009
Member Rating: 4.3


(1)
Message 603 of 693 (807503)
05-03-2017 11:22 AM
Reply to: Message 585 by Dredge
05-03-2017 12:41 AM


Re: Part of the problem?
Dredge writes:

If so, then it is possible to accept evolution as a fact without believing that all life evolved from a common ancestor.

The question is why you would reject the conclusion of a universal common ancestor when we have mountains of evidence to support the conclusion.

"The theory of evolution is the process by which organisms change over time as a result of changes in heritable physical or behavioural traits." This definition contains nothing at all about "how it happens" - as in your definition.

Wiki's definition of the theory of evolution is more like your definition of evolution ie, "heritable change in a population". Quite a difference.

Is it any wonder creationists get confused about definitions of "evolution" and "the theory of evolution", when evolutionists themselves can't even agree?

Why the obsession with definitions? Why would you expect a one sentence definition on Wikipedia to cover the entire breadth of the theory?


This message is a reply to:
 Message 585 by Dredge, posted 05-03-2017 12:41 AM Dredge has responded

Replies to this message:
 Message 606 by CRR, posted 05-04-2017 5:26 AM Taq has responded
 Message 631 by Dredge, posted 05-05-2017 6:06 AM Taq has responded

  
Dredge
Member
Posts: 350
From: Australia
Joined: 09-06-2016
Member Rating: 1.2


Message 604 of 693 (807561)
05-04-2017 3:12 AM
Reply to: Message 578 by Dr Adequate
05-02-2017 10:01 AM


Re: Where are we now?
And you are pathetically, ludicrously wrong.

Actually, you're right; so I'll go back to something like my original definition of evolution. In biology, the word, "evolution" can't be separated from Darwin's theory, which obviously has common descent at it's core. The gratuitous, ubiquitous and misleading use of the word, "evolution" in the biological sciences is always an allusion to Darwinism, which I reject as false, useless and irrelevant.

So to hell with ToE, just give me biology and I'll be happy. As Danno used to say, "Just the facts, ma'am." (Danno would have made an excellent biologist ... but a lousy evolutionist.)

When I become King of Australia I'll ban the teaching of ToE at all levels of education, thereby draining the swamp that the once-noble science of biology has become, liberating and cleansing it from the mendacious theology of atheist cultism.

Evolution = Biology + the atheist cult of Darwinism


This message is a reply to:
 Message 578 by Dr Adequate, posted 05-02-2017 10:01 AM Dr Adequate has responded

Replies to this message:
 Message 618 by Dr Adequate, posted 05-04-2017 9:36 AM Dredge has responded
 Message 621 by Tangle, posted 05-04-2017 3:29 PM Dredge has responded
 Message 624 by 1.61803, posted 05-04-2017 4:56 PM Dredge has not yet responded

    
Dredge
Member
Posts: 350
From: Australia
Joined: 09-06-2016
Member Rating: 1.2


Message 605 of 693 (807562)
05-04-2017 3:15 AM
Reply to: Message 573 by Pressie
05-02-2017 8:07 AM


Re: If Not, What?
Pressie writes:

unlike you, those protozoans don't even pretend to have brains!

Oh, that's not a very nice thing to say. And besides, would you call someone who took twelve years to complete seven years of primary school brainless?

Edited by Dredge, : No reason given.


This message is a reply to:
 Message 573 by Pressie, posted 05-02-2017 8:07 AM Pressie has responded

Replies to this message:
 Message 609 by Pressie, posted 05-04-2017 6:06 AM Dredge has not yet responded

    
CRR
Member
Posts: 234
From: Australia
Joined: 10-19-2016
Member Rating: 1.2


Message 606 of 693 (807574)
05-04-2017 5:26 AM
Reply to: Message 603 by Taq
05-03-2017 11:22 AM


Re: Part of the problem?
I agree, Taq, universal common ancestry is inseparable from both Darwin's theory of evolution and the modern synthesis. E.g. Theodosius Dobzhansky concedes that there could have been more than one original form of life but that only one survived as the universal common ancestor. Charles Darwin was building on the tree of life idea that preceded him and published by Erasmus Darwin.

Common ancestry is a core of the definitions given by both Kerkut and Coyne that I previously quoted.

Dredge is right. There is more than one definition of the theory of evolution. This leads to people claiming evolution has been proved when they are only talking about minor changes in allele frequencies, not even speciation let alone common ancestry.


This message is a reply to:
 Message 603 by Taq, posted 05-03-2017 11:22 AM Taq has responded

Replies to this message:
 Message 652 by Taq, posted 05-08-2017 1:18 PM CRR has not yet responded

  
CRR
Member
Posts: 234
From: Australia
Joined: 10-19-2016
Member Rating: 1.2


Message 607 of 693 (807575)
05-04-2017 5:42 AM
Reply to: Message 589 by Dredge
05-03-2017 2:03 AM


Genome sizes
Dredge, the lack of correlation between phenotype complexity and genome size is known as the C-Value Paradox. This has not been resolved yet but remember we are still learning about the genome. The ENCODE results were published in 2003 and there has been a lot of progress since then but there's still a long way to go. There is still no satisfactory evolutionary explanation for the c-value so we will probably have to wait for more research.

Like you I believe that eventually we will find that a human contains more genetic information than an amoeba.

[edit] This is probably an issue that is peripheral to the thread topic and should be addressed elsewhere.

Edited by CRR, : No reason given.


This message is a reply to:
 Message 589 by Dredge, posted 05-03-2017 2:03 AM Dredge has responded

Replies to this message:
 Message 608 by Pressie, posted 05-04-2017 6:00 AM CRR has not yet responded
 Message 630 by Dredge, posted 05-05-2017 6:03 AM CRR has not yet responded

  
Pressie
Member
Posts: 1605
From: Pretoria, SA
Joined: 06-18-2010
Member Rating: 2.3


(2)
Message 608 of 693 (807576)
05-04-2017 6:00 AM
Reply to: Message 607 by CRR
05-04-2017 5:42 AM


Re: Genome sizes
Thank you for acknowledging that there's no way to determine whether organism A or organism B has more or less genetic information.

I know that you're trying to fool people like yourself and Dredge by using sciencey sounding language; but sciencey sounding language is not science. We're not all too stupid to be fooled by sciencey sounding language, CRR.

So, the honourable thing to do by you and Dredge would be to acknowledge that genetic information can't be measured at the moment. And that you can't say whether Organism A or Organism B has "more genetic information".


This message is a reply to:
 Message 607 by CRR, posted 05-04-2017 5:42 AM CRR has not yet responded

    
Pressie
Member
Posts: 1605
From: Pretoria, SA
Joined: 06-18-2010
Member Rating: 2.3


Message 609 of 693 (807577)
05-04-2017 6:06 AM
Reply to: Message 605 by Dredge
05-04-2017 3:15 AM


Re: If Not, What?
Actually, I complimented your accomplishments. Your last accomplishment was that your way of measuring "genetic information" lead to the conclusion that some forms of Amoebas have more genetic information than humans. I agree with that when it comes to intelligence. Remember your "infos"?

Edited by Pressie, : No reason given.

Edited by Pressie, : No reason given.


This message is a reply to:
 Message 605 by Dredge, posted 05-04-2017 3:15 AM Dredge has not yet responded

    
Dredge
Member
Posts: 350
From: Australia
Joined: 09-06-2016
Member Rating: 1.2


Message 610 of 693 (807578)
05-04-2017 6:14 AM
Reply to: Message 594 by Pressie
05-03-2017 6:20 AM


Re: If Not, What?
Pressie writes:

Without a unit of measurement you can't make such a claim

I can make such a claim and I just did. DNA is an instruction manual for building a machine. A human machine is much more complex than an amoeba machine, therefore much more information is needed in the human's instruction manual. Compare the contents of an instruction manual to build an mouse trap compared to the contents of instruction manual to build a space shuttle.

Simple, common sense logic, my friend.

Edited by Dredge, : No reason given.

Edited by Dredge, : No reason given.

Edited by Dredge, : No reason given.


This message is a reply to:
 Message 594 by Pressie, posted 05-03-2017 6:20 AM Pressie has responded

Replies to this message:
 Message 611 by Pressie, posted 05-04-2017 6:17 AM Dredge has not yet responded
 Message 614 by Pressie, posted 05-04-2017 6:37 AM Dredge has responded
 Message 619 by Dr Adequate, posted 05-04-2017 9:38 AM Dredge has not yet responded

    
Pressie
Member
Posts: 1605
From: Pretoria, SA
Joined: 06-18-2010
Member Rating: 2.3


Message 611 of 693 (807579)
05-04-2017 6:17 AM
Reply to: Message 610 by Dredge
05-04-2017 6:14 AM


Re: If Not, What?
Nope. Word salads, again. You don't want to answer the question. Quantify before saying "more". Quantify genetic information before saying "more" or "less".

Edited by Pressie, : No reason given.


This message is a reply to:
 Message 610 by Dredge, posted 05-04-2017 6:14 AM Dredge has not yet responded

    
Dredge
Member
Posts: 350
From: Australia
Joined: 09-06-2016
Member Rating: 1.2


Message 612 of 693 (807580)
05-04-2017 6:27 AM
Reply to: Message 601 by Taq
05-03-2017 11:17 AM


Re: If Not, What?
Taq writes:

Assuming you are referring to Jack Chick

No, no, no; not Jack Chick! "Chicko" is the dog that lives next door to me; an American bull terrier. He talks to me and gives me all sorts of advice and infallible information.


This message is a reply to:
 Message 601 by Taq, posted 05-03-2017 11:17 AM Taq has not yet responded

    
Dredge
Member
Posts: 350
From: Australia
Joined: 09-06-2016
Member Rating: 1.2


Message 613 of 693 (807581)
05-04-2017 6:29 AM
Reply to: Message 602 by Taq
05-03-2017 11:19 AM


Re: If Not, What?
I not sure. Perhaps 200 infos. But I'll show it to Chicko and let him work it out exactly.
This message is a reply to:
 Message 602 by Taq, posted 05-03-2017 11:19 AM Taq has not yet responded

    
Pressie
Member
Posts: 1605
From: Pretoria, SA
Joined: 06-18-2010
Member Rating: 2.3


Message 614 of 693 (807582)
05-04-2017 6:37 AM
Reply to: Message 610 by Dredge
05-04-2017 6:14 AM


Re: If Not, What?
Dredge writes:

....DNA is an instruction manual for building a machine...

I'm trying to figure out what you're trying to say. My car is a machine. It's got no inheritable DNA. My car doesn't have kiddies. What's your point?.
This message is a reply to:
 Message 610 by Dredge, posted 05-04-2017 6:14 AM Dredge has responded

Replies to this message:
 Message 615 by Dredge, posted 05-04-2017 6:57 AM Pressie has responded

    
Dredge
Member
Posts: 350
From: Australia
Joined: 09-06-2016
Member Rating: 1.2


Message 615 of 693 (807583)
05-04-2017 6:57 AM
Reply to: Message 614 by Pressie
05-04-2017 6:37 AM


Re: If Not, What?
Pressie writes:

What's your point?

All living organisms are biological machines. DNA provides the instructions for building biological machines.


This message is a reply to:
 Message 614 by Pressie, posted 05-04-2017 6:37 AM Pressie has responded

Replies to this message:
 Message 616 by Pressie, posted 05-04-2017 7:58 AM Dredge has responded
 Message 617 by RAZD, posted 05-04-2017 9:08 AM Dredge has responded
 Message 620 by ringo, posted 05-04-2017 12:08 PM Dredge has not yet responded

    
RewPrev1
...
3940
41
4243
...
47Next
Newer Topic | Older Topic
Jump to:


Copyright 2001-2015 by EvC Forum, All Rights Reserved

™ Version 4.0 Beta
Innovative software from Qwixotic © 2017