Macroevolution: Its all around us...

On the first part of your post, my understanding is that is not the only study, and that the evidence does indicate a larger convergent effect for DNA.WK probably could provide better details, but at the same time, I think there is a considerable level of research going on, and we don't have a full picture yet. The pattern itself is a design. It doesn't just indicate a design. I should be more careful. It is a design that preexists based on whatever is causing it, which is presumed at this stage to the chemical properties in the local environment. Chemistry may be the result of the pattern, but the pattern is a design that already exists then, which is based on the properties of chemistry. Either way, we are beginning to have to go beyond biology to understand what occurs. The biology is dependant on the DNA which is influenced and dependant on chemistry which is affected by physics, including quantum physics.Imo, if we are going to get a good grasp of what is really going on, we need a comprehensive understanding of quantum physics, chemistry, and molecular genetics.I suspect once we view the entirety of the process, we will see a mechanism for direct design influencing "natural processes".This message has been edited by randman, 06-23-2005 02:37 PM

No, not at all.

The first part of my post was the part most pertinent to this discussion.You can't dismiss my comments by simply claiming, "I think there is more evidence out there that agrees with me."Provide the evidence. Don't just tell me it might exist.
_______________________________________As a note, from the Vowles and Amos paper:

​

To our knowledge, no one has yet conducted a systematic study of mutational biases operating around microsatellites.

​

It appears they were the first to conduct an in-depth study of the problem. Neither author has published on the subject since then. And according to the ISI Web of Science the article has not yet been cited by another article. Since it's only been a year, this is not a great surprise, but it does suggest that there isn't a large community studying the problem...

As I was going home I did think that I was overstating things, especially given the small size of the repeats, the length with the greatest effect was (AC)9 and 18 bps isn't really too much to fit into a region near a gene, or even within a gene itself, its only 6 amino acids after all. So on reflection I was definitely overstating this.The Amos and Vowles paper does draw a distinction between the phenomena they observe and that of repeat expansion/slippage but the Dog paper certainly shows that the microsatellites are ther within the regions containing protein coding genes.TTFN,WK

Yes -- I believe it would be a good idea to be more careful. Particularly here, since a pattern is a design only in the sense that a design is a pattern -- and in no way implies the presence or absence of a designer. Your creationism isn't simply slipping -- it is a form of slipping -- from one meaning of a term to another...This message has been edited by TimChase, 06-23-2005 03:36 PM

I'm now wondering about the strength of this form of "convergent evolution" - in my mind I think of it as a rather "weak" force that would not be able to overcome the "strong" selective force of maintaining a phenotypically beneficial gene or sequence.Also, it seems to me that the convergent pattern they suggest would be unlikely to converge to functional gene sequence; that is, the pattern they uncover is unlike the vast majority of gene sequences. Do you think that is a fair conclusion?

But between species? How do the specific "seed" sequences get from one species to another? It would seem that you would need genetic information to have passed, at one time, from one species to another; so you're back to two alternatives:1) Some unknown mechanism of horizontal gene exchange between species.
2) Common descent.If Randman is trying to explain genetic similarities by recourse to convergence, he has a problem that his model recourses to genetic sequences that convergence can't possibly explain.

Precisely. These are the two reasonable possibilities.This is want I was hinting at with the comparison to endogenous retroviruses.

In the specific case of dinucleotide repeats analyzed in the article, it is quite likely that they arose independently, and thus do not need "seeds" (though once formed they are heritable to "daughter species").This is the case because dinucleotide repeats are hypermutable, and are especially good at expanding and contracting. Keep in mind that in the paper WK referenced, the sequence:ACACwas all that was required to significantly influence mutational bias in flanking sequences - a "seed" sequence is not needed to explain four bases. If that sequence expands to:ACACACACACthe influence is much greater, and moreso at (AC)9, etc...Thus using sequence in or around such repeats could create confounding results. What randman doesn't seem to have grasped yet is that the rest of the genome remains to be used to establish common ancestry, since it doesn't appear that the convergent mutational bias is a particular issue for other types of sequence. Also, from my reading of the paper the flanking sequence is not converging to specific non-repetitive sequence, but rather is developing a simple pattern, and may indeed be converging to simple repetitive sequence itself...

Thanks. That's about the best clarification yet of this phenomenon and the extent of its implications - at least for us non-molecular types

Agreed. And quite honestly it has become clear to me that I have some catchup to do -- sasquatch aquatic, PaulK, Wounded King, and crashfrog had some really good analyses!

Oh.Wait, this is new? How so? I mean, knowing that the most common mutations are the ones that extend repeating sequences, this seems obvious.How is this "convergent"? I mean there's nothing here that would prevent one species from having, say, 20 repeats of "AC", and another from having 200, right? They don't "converge" on a sequence; if anything, they diverge.

I think I've seen you yourself post descriptions of how repeats allow "slippage" errors during replication to expand or contract repeats.This is new because it is quite different from that mode of mutation - the paper describes such repeats biasing mutation in non-repetitive flanking sequence at some distance, separate of slippage, so that a sequence like (repeat in red):GTGACGGGTACGTACACACACACACACGCGCTATATAGCwould converge via biased mutation or stabilization to something like:GAGACAGATACATACACACACACACACGAGATATATAGA(Someone please correct me if I misread the paper.)See how a pattern is forming, not due to simple slippage-based expansion/contraction? That is what is novel about the results...This message has been edited by the sasquatch aquatic, 06-23-2005 06:06 PM

You have no evidence offered to back up such a view. Furthermore, your idea assumes that the pattern would run contrary to the "selective force" when the opposite could well be the case. No, it does not seem like a fair conclusion. Can you elaborate?I think there should also be a recognition in considering this that some "solutions" may be equally positive for selection, but in that case, the pattern that first and most frequently emerges is more likely to emerge dominant.

Your post, imo, seems nonsensical. Why is there any necessity of "seed" sequences to get from one species to another.