|
Register | Sign In |
|
QuickSearch
EvC Forum active members: 66 (9164 total) |
| |
ChatGPT | |
Total: 916,477 Year: 3,734/9,624 Month: 605/974 Week: 218/276 Day: 58/34 Hour: 1/3 |
Thread ▼ Details |
Member (Idle past 5076 days) Posts: 125 From: Brooklyn, New York Joined: |
|
Thread Info
|
|
|
Author | Topic: The Truth About Evolution and Religion | |||||||||||||||||||||||||||||||||||||||||||
Iblis Member (Idle past 3917 days) Posts: 663 Joined:
|
It stands to reason there were processes, but the process could not be natural selection. Take a box of letters and dump them out somewhere (level 0). Pick out any words you see and stick them somewhere else (level 1) in the order that you found them. When you can't find anymore words, move to Level 1. Pick out any sentences you see, and stick them yet another place (level 2) in the order that you found them. When you can't find anymore sentences, move to Level 2. Take any paragraphs that you notice and move them along sequentially (level 3). Separate paragraphs ought to be good enough, you ran out of tiles in just one box before you get to chapters. So fine, now work your way through again. Take everything still at level 0, non-words, and slide it back into the box and dump it out again. Letters to words, words to sentences, sentences to paragraphs. Fill in empty spaces in order. When you are stumped at a level, nowhere to start. take the last entity involved, count the number of sub-entities, and move it forward that far in the rotation before skipping ahead. Keep going, round and round. It won't take a billion years, it won't take a million years. It will happen fast. Natural selection, arbitrary mutation. Seriously, do you play poker? Would you like to? Seriously.
|
|||||||||||||||||||||||||||||||||||||||||||
Wounded King Member Posts: 4149 From: Cincinnati, Ohio, USA Joined:
|
The reason there is no calculation like that, I am suggesting, is that no one is trying to argue that the complexity of life can be explained by natural selection. No there is no calculation like that because such calculations serve no purpose, beyond supplying creationists with big numbers. The fact that most modern proteins are over 100 amino acids doesn't mean that all functional protein sequences must be over 100 amino acids. As has been repeated ad nauseam what no one is saying is that the chances of a particular protein 100 amino acids long just spontaneously assembling which had a biological function are relevant to explaining the complexity of life, no one except you that is. What those calculations address has nothing to do with evolution except to show how evolution differs from mere random chance. I can't even tell what you think you are arguing about. Is it abiogenesis? Once any self replicating population of genetic sequences arises, lets say self catalysing RNAs for arguments sake, then all you probability objections based on spontaneous assembly by chance become totally pointless. There is certainly no point saying 'look at the timing of biological processes, they are too complex to arise by chance', because no one is suggesting that they have. Conflating evolution with pure chance is simply lazy, and I can't imagine who you think you will fool other perhaps than yourself. If you want to look at a suitable target for such calculations why not look at the self replication RNAzymes talked about upthread. Paul and Joyce (2002) describe such a system and it requires only 3 sequences of 13, 48 and 55 nucleotides respectively the 48 nucleotide sequence is a shorter form of the 55 nucleotide sequence. In detail ...
Part A: GGAUUGUGCUCGAUUGUUCGUAAGAACAGUUUGAAUGGGUUGAAUAUAGAGACCG Part B: GGAUUGUGCUCGAUUGUUCGUAAGAACAGUUUGAAUGGGUUGAAUAUA Part T: GAGACCGCAAUCC These are sequences composed from 4 different bases, so what are the correct calculations here (4X10^55)X(4X10^48)X(4X10^13) which I make out to be 6.4 10^117. Even assuming that only this is the only possible self replicating system, which I doubt, it seems to be a not impossible level of improbability. It is below Dembski's Universal probability bound and certainly it is many order of magnitude below Salisbury's calculations. Statistics isn't my strong point so anyone wanting to point out an obvious error in just multiplying the probabilities together let me know. How long do you think it would take a computer to generate those sequences randomly from an alphabet of 4 letters? There is no reason to imagine this presents the minimal system for such replication but it is one we know the exact details of. TTFN, WK
|
|||||||||||||||||||||||||||||||||||||||||||
Woodsy Member (Idle past 3396 days) Posts: 301 From: Burlington, Canada Joined: |
We don't doubt that complexity evolved. The question is what were the processes? It stands to reason there were processes, but the process could not be natural selection. The U. Mich lessons say nothing unscientific. But the Berkeley lesson says natural selection explains the complexity of life. Likewise Gerhart and Kirsner and Kenneth Miller do not say natural selection explains the complexity of life, but Richard Dawkins does. Who cares what someone says in some book you have managed to dig up? What counts is what is. In any case, you are ignoring the ratcheting effect of natural selection. The important point is that helpful variations are sometimes retained. Sometimes these useful variations are more complex, sometimes not. Once retained, complexity can be increased by further rounds of the same effect. What is so hard about all this? It's a very simple algorithm that anyone should be able to grasp easily. It does not even need to instantiated in biological systems but can happen in other contexts, such as , for example, computer programs or cultural artifacts. Anytime variation is coupled with selection, evolution happens.
|
|||||||||||||||||||||||||||||||||||||||||||
Percy Member Posts: 22480 From: New Hampshire Joined: Member Rating: 4.8 |
Hi WK,
About statistics, what I think what you actually calculated is one over the probability of getting the proper three sequences of A, B and T in a single trial. But the A, B and T sequences are presumably constructed independently, rather than all together in a single trial? And on a planet sized body there could be literally bazillions of trials? And there must be a number of unknown factors (given our lack of certainty about conditions on the ancient Earth) governing the construction and breaking down of nucleotide sequences? Unlike creationists, I don't think we're in a position to calculate probabilities of even simple sequences like A, B and T, but I think your number probably represents an extremely low lower bound. --Percy
|
|||||||||||||||||||||||||||||||||||||||||||
dkroemer Member (Idle past 5076 days) Posts: 125 From: Brooklyn, New York Joined: |
I have already proved by citing facts and authorities that natural selection explains only adaptation, not common descent. This group responds by giving me lectures about evolution and by saying you can't prove you are right by quoting biology textbooks and experts in the field. My YouTube video gives a very concise and easy-to-understand refuation of Darwinism.
This group is not interested in biology, but in justifying their immature feeling that they are more enlightened and more rational that people who believe in God: Muslims, Jews, Christians, Hindues, and Budhhists. Since opponents of Darwinism tend to be religious, promoting Darwinism is an exercise in bigotry. I'll explain again without citing authorities that Darwinism is hogwash. It was understood from the very beginning that natural selection could not explain the evolution of something as complex as the human eye. With the discovery of the structure of proteins and DNA it was possible to quantify the complexity of life by caculating the probability of a protein evolving by random chance. A very crude calculation is one in 20600. I pick the number 600 because that is the number of letters in a sonnet. I mention sonnets because the number of letters in the alphabet is about equal to the number of amino acids. This calculation is crude for two reasons. It ignores natural selection and it assumes that the jumping around of amino acids is what produces complexity. My layman's understanding of faciliated variation is that it is clumps of amino acids that jump around in evolution. A computer program can simulate evolution by calculating how long it would take a computer to reproduce a sonnet by randomly generating dictionary words. Dictionary words, not letters, because of facilitated variation. Natural selection is accounted for by accumulating partial reproductions of the sonnet. So far as I know, this calculation has only been done for short sequences, for example, "to be or not to be." A computer can generate a short phrase in a short length of time. Without facilitated variation and natural selection, that is, just randomly generating letters and spaces, the time is millions of years. The weakness of these calculations is that it assumes that the complexity of the primary structure of a protein is a measure of the complexity of life. In my opinion, this does not even begin to describe the complexity of life. It excludes the complex molecular machinery and the timing of biological processes. This is why the calculation is done only for short sequences of words. To do the calculation for a whole sonnet would imply that you think the primary structure of a protein describes the complexity of life. Biologists, with the exception of anti-religous fanatics like Dawkins, understand that life is too complex to have evolved through natural selection.
|
|||||||||||||||||||||||||||||||||||||||||||
dkroemer Member (Idle past 5076 days) Posts: 125 From: Brooklyn, New York Joined: |
They mean high degrees of complexity can't evolve by Darwinian mechanisms. They are quite right, as I explain, yet again, in detail in detail a few minutes ago.
|
|||||||||||||||||||||||||||||||||||||||||||
Huntard Member (Idle past 2317 days) Posts: 2870 From: Limburg, The Netherlands Joined: |
dkroemer writes:
Actually, all biologists (well, maybe some don't), think that life has evolved, and it's evolved through more than just natural selection. Why do you keep limiting yourself to just that? Biologists, with the exception of anti-religous fanatics like Dawkins, understand that life is too complex to have evolved through natural selection. Please answer the question.
|
|||||||||||||||||||||||||||||||||||||||||||
dkroemer Member (Idle past 5076 days) Posts: 125 From: Brooklyn, New York Joined: |
I discuss this in a post I made a few minutes ago.
|
|||||||||||||||||||||||||||||||||||||||||||
dkroemer Member (Idle past 5076 days) Posts: 125 From: Brooklyn, New York Joined: |
I just answered this a few minutes ago.
|
|||||||||||||||||||||||||||||||||||||||||||
dkroemer Member (Idle past 5076 days) Posts: 125 From: Brooklyn, New York Joined: |
I just answered this a few minutes ago.
|
|||||||||||||||||||||||||||||||||||||||||||
dkroemer Member (Idle past 5076 days) Posts: 125 From: Brooklyn, New York Joined: |
I just answered this in a lengthy reply.
|
|||||||||||||||||||||||||||||||||||||||||||
Woodsy Member (Idle past 3396 days) Posts: 301 From: Burlington, Canada Joined: |
It was understood from the very beginning that natural selection could not explain the evolution of something as complex as the human eye. This is not true. Even Darwin showed how it could be done.
With the discovery of the structure of proteins and DNA it was possible to quantify the complexity of life by caculating the probability of a protein evolving by random chance. A very crude calculation is one in 20600. I pick the number 600 because that is the number of letters in a sonnet. I mention sonnets because the number of letters in the alphabet is about equal to the number of amino acids. No one is claiming that these molecules occurred by random chance. Your calculation is irrelevant. Your position is a political one, not a scientific one. Your goal is to promote ignorance and superstition. It is amazing that you are not embarrassed by your blatant falsehoods.
|
|||||||||||||||||||||||||||||||||||||||||||
Modulous Member Posts: 7801 From: Manchester, UK Joined: |
This calculation is crude for two reasons. It ignores natural selection and it assumes that the jumping around of amino acids is what produces complexity. My layman's understanding of faciliated variation is that it is clumps of amino acids that jump around in evolution. You've confused a single example of 'biased variation' using English Words with the 'facilitated variation' of biological phenotypes that they were talking about. You can just look it up, I think they wrote a book about it. I think you might have referenced it once or twice actually. Anyway, wikipedia should give you a brief rundown that'll give you as close to a layman's understanding as one can get.
|
|||||||||||||||||||||||||||||||||||||||||||
subbie Member (Idle past 1277 days) Posts: 3509 Joined:
|
I'll explain again without citing authorities that Darwinism is hogwash. *** This calculation is crude for two reasons. It ignores natural selection.... You intend to disprove "Darwinism" by ignoring natural selection. *blink* *blink* Well, I'm going to debunk the Shroud of Turin. I'll begin by assuming that Christ never existed. Your calculation is meaningless for at least two reasons, both of which have been pointed out to you in this thread and one of which you seem to acknowledge. First, if that number means anything, it is the odds of all 26 amino acids that you mention coming together all at once in one fell swoop. It ignores the possibility of them coming together slowly, bit by bit, over time. You know, the way science believes they did. You understand this fact, yet account for it only by admitting that your number is "crude." It seems to me that this flaw renders your number not crude, but empty. Second, your number assumes that those 26 amino acids were a target that the process was trying to reach. You need to prove that is the case and I don't think you can. Look at it this way. The odds of anyone getting 13 spades in bridge in a random deal are approximately 1 in 650,000,000,000. Does this mean that it's virtually impossible for anyone to make a contract of 7 spades?
So far as I know, this calculation has only been done for short sequences, for example, "to be or not to be." As far as I know, your "calculation" hasn't been done for even that sequence, at least not by anyone who knows anything about evolution. It would be irrelevant. If you can find a place where a scientist has done this calculation, I'd be interested in seeing it. Ridicule is the only weapon which can be used against unintelligible propositions. Ideas must be distinct before reason can act upon them; and no man ever had a distinct idea of the trinity. It is the mere Abracadabra of the mountebanks calling themselves the priests of Jesus. -- Thomas Jefferson For we know that our patchwork heritage is a strength, not a weakness. We are a nation of Christians and Muslims, Jews and Hindus -- and non-believers. -- Barack Obama We see monsters where science shows us windmills. -- Phat It has always struck me as odd that fundies devote so much time and effort into trying to find a naturalistic explanation for their mythical flood, while looking for magical explanations for things that actually happened. -- Dr. Adequate
|
|||||||||||||||||||||||||||||||||||||||||||
lyx2no Member (Idle past 4738 days) Posts: 1277 From: A vast, undifferentiated plane. Joined: |
The odds of "On the Origin of Species" coming about by random letter selection is 335oo,ooo. So what? My calculation is rubbish because "On the Origin of Species" didn't come about by random letter selection.
Natural selection is non-random. It is responsible for complexity in that if it weren't for its non-random habit life would have remined puddle ooze. "Mom! Ban Ki-moon made a non-binding resolution at me." Mohmoud Ahmadinejad
|
|
|
Do Nothing Button
Copyright 2001-2023 by EvC Forum, All Rights Reserved
Version 4.2
Innovative software from Qwixotic © 2024