Register | Sign In


Understanding through Discussion


EvC Forum active members: 65 (9162 total)
5 online now:
Newest Member: popoi
Post Volume: Total: 915,815 Year: 3,072/9,624 Month: 917/1,588 Week: 100/223 Day: 11/17 Hour: 0/0


Thread  Details

Email This Thread
Newer Topic | Older Topic
  
Author Topic:   Evolutionary Adaptation
arachnophilia
Member (Idle past 1343 days)
Posts: 9069
From: god's waiting room
Joined: 05-21-2004


Message 11 of 115 (318492)
06-06-2006 11:06 PM
Reply to: Message 9 by Someone who cares
06-06-2006 10:59 PM


And, you can get variation, but also, within limits, within the kind of the organism.
please explain the mechanism that limits variation, and prevents variation from compounding.


This message is a reply to:
 Message 9 by Someone who cares, posted 06-06-2006 10:59 PM Someone who cares has replied

Replies to this message:
 Message 14 by Someone who cares, posted 06-06-2006 11:25 PM arachnophilia has replied

  
arachnophilia
Member (Idle past 1343 days)
Posts: 9069
From: god's waiting room
Joined: 05-21-2004


Message 44 of 115 (319497)
06-09-2006 10:28 AM
Reply to: Message 14 by Someone who cares
06-06-2006 11:25 PM


It's not like there is a mechanism for it, to stop a monkey from evolving into a human, or a reptile from evolving into a bird. It is the genetic code of an organism. The code is "preset" when the organism is born. There is code for only the traits and organs and tissues of that organism.
if i were to take your post, and change it one letter at a time, could i ever make it say something different?
No new code can be added to the genetic code of an organism to make it evolve into a different kind of organism. It cannot happen. It never has. It never will.
duplication errors are a fairly regular occurance. in fact, i think you will find that humans quite regularly have a whole extra chromosome.
XYY syndrome - Wikipedia
Klinefelter syndrome - Wikipedia
Trisomy X - Wikipedia
that's a whole extra copy of a chromosome, not just an extra gene.
That fish over there will never have code added to it, naturally, to make it start evolving legs or parts of them or something. It's not going to happen.
except, of course, for the fish that do have legs.


This message is a reply to:
 Message 14 by Someone who cares, posted 06-06-2006 11:25 PM Someone who cares has replied

Replies to this message:
 Message 56 by Someone who cares, posted 06-09-2006 9:40 PM arachnophilia has replied

  
arachnophilia
Member (Idle past 1343 days)
Posts: 9069
From: god's waiting room
Joined: 05-21-2004


Message 59 of 115 (319751)
06-09-2006 9:46 PM
Reply to: Message 56 by Someone who cares
06-09-2006 9:40 PM


With random changes, you could make it more messed up and misspelled and confusing, perhaps even impossible to read. But you could not exchange some of my words and make synonyms for those words that would be more scholarly sounding or more scientific or better sounding. That's the whole point.
there was a member a while back, a really nutter, who kept going on about moses's cd-rom collection. he was using strong's concordance to find alternate renderings of certain words in the bible, and derive some higher meaning (about cd-roms) from them.
so i began using his methods against him. at one point, i was "translating" his own posts against him. it was actually quite entertaining.
so, yes, you can do it. i have.
That is called DUPLICATION, which means, making an extra copy of PREVIOUSLY existing code! MY POINT! That's the best you could do, you couldn't add new code for new cells or tissues or organs or something. You could ONLY duplicate that which had already existed! This is my point!
whoa whoa. wait a second, engage the brain a little.
if i have the following string of numbers:
1, 2, 3, 4, 5, 6, 7, 8
and i duplicate one number:
1, 2, 3, 4, 5, 6, 7, 8, 8
and then i modify one number:
1, 2, 3, 4, 5, 6, 7, 8, 9
tada, new data.


This message is a reply to:
 Message 56 by Someone who cares, posted 06-09-2006 9:40 PM Someone who cares has replied

Replies to this message:
 Message 68 by Someone who cares, posted 06-09-2006 10:01 PM arachnophilia has replied

  
arachnophilia
Member (Idle past 1343 days)
Posts: 9069
From: god's waiting room
Joined: 05-21-2004


Message 62 of 115 (319756)
06-09-2006 9:51 PM
Reply to: Message 61 by Someone who cares
06-09-2006 9:48 PM


I was actually feeling pity for the person, and you come in and say that was insulting? Please...
pity is very often insulting.
contrast with compassion.


This message is a reply to:
 Message 61 by Someone who cares, posted 06-09-2006 9:48 PM Someone who cares has not replied

  
arachnophilia
Member (Idle past 1343 days)
Posts: 9069
From: god's waiting room
Joined: 05-21-2004


Message 71 of 115 (319772)
06-09-2006 10:08 PM
Reply to: Message 68 by Someone who cares
06-09-2006 10:01 PM


I'm sure you weren't blindfolded and unconscience when you were doing it...
i could just as easily have picked words at random out of a thesaurus, and selected the variations i thought were favorable.
Who or what allowed you to modify the 8 into a 9?
simple variation, which you agreed happens. i kept it "within it's kind" too: single digits.


This message is a reply to:
 Message 68 by Someone who cares, posted 06-09-2006 10:01 PM Someone who cares has replied

Replies to this message:
 Message 74 by Someone who cares, posted 06-09-2006 10:13 PM arachnophilia has replied

  
arachnophilia
Member (Idle past 1343 days)
Posts: 9069
From: god's waiting room
Joined: 05-21-2004


Message 78 of 115 (319784)
06-09-2006 10:19 PM
Reply to: Message 74 by Someone who cares
06-09-2006 10:13 PM


But you, are an intelligent being. You are conscience and smart when you do that. But evolution is supposed to be unguided, and random, without direction...
no, not exactly. the words i italicized above were intentional. evolution has a random component, yes: variation. but the other component, selection is not random. it is based (in nature) on fitness and sexual factors. we can also artificially control it, ourselves. selection can be, and often is, an intelligent process.
But the 9 never existed before, where did you get it from?
i added one.
here's a better example, if you'd like:
GACTGCGATAGCTAGCTAGA
becomes
GACTGGCGATAGCTAGCTAGA
becomes:
GACTGACGATAGCTAGCTAGA
where did the extra G come from? duplication. where did the A come from? variation. duplication + variation = "new" data.


This message is a reply to:
 Message 74 by Someone who cares, posted 06-09-2006 10:13 PM Someone who cares has not replied

  
Newer Topic | Older Topic
Jump to:


Copyright 2001-2023 by EvC Forum, All Rights Reserved

™ Version 4.2
Innovative software from Qwixotic © 2024