|
Register | Sign In |
|
QuickSearch
Thread ▼ Details |
|
Thread Info
|
|
|
Author | Topic: Fact Theory Falacy | |||||||||||||||||||||||
joz Inactive Member |
quote: Posted this earlier but here we go again.... From:
http://bostonreview.mit.edu/br22.1/doolittle.html quote: IOW the original gene was duplicated then changed enough to assume a function (the duplicate had no function before as the original kept its own role), Does that qualify as new information to you?
|
|||||||||||||||||||||||
TrueCreation Inactive Member |
"Nylon digestion by bacteria has been observed naturally and then replicated in the lab. Of course, the words you are using are rather difficult to define. How exactly are you defining information and measuring it? What is incline and decline in a manner that is quantifiable?"
--Hm.. this is a bit tough to define, lets see what we can do. I guess it would go a little something like this: You have:AGTTACCCTCAAGTTC --Mutation involves this sequence of mistranslations:AGTTAC|CCTC|AAGTTC| A mutation takes place and is re-arranged:AGTTAC|GTTC|CCTCAA| This happens ofcourse, this is another example of something that happens: Your sequence:GTTACTTCCCATATCCGGTGGCCAGGG GTTACTTCCCATA|TCCGG|TGGCCAGGG| A peice is removed and this is your product from mutation:GTTACTTCCCATA|TGGCCAGGG| or: GTTACTTCCCATA|TCCGG --This is basically what you need: This: AGGTCTCAACTAGTCTGGAGGCTGA And By mutational effects get this: |-New information-| AGGTCTCAACT|-CTAG-|TGGA|-AGT-|TGA|-AGTAACTACCTGTG-| --By my knowledge this seems to be what you need for new 'information' to come about. ------------------
|
|||||||||||||||||||||||
mark24 Member (Idle past 5223 days) Posts: 3857 From: UK Joined: |
Not sure what you're driving at TC, perhaps a definition of new information is in order?
Mark ------------------Occam's razor is not for shaving with. [This message has been edited by mark24, 02-08-2002]
|
|||||||||||||||||||||||
TrueCreation Inactive Member |
"Not sure what you're driving at TC, perhaps a definition of new information is in order?"
--See above, I gave examples on what new information would be as a string of bases, this is what new information is to my knoweldge that 'E'volution needs. quote: ------------------
|
|||||||||||||||||||||||
joz Inactive Member |
TC you seem to have missed my earlier post so once again I refer you to post 47 at the top of this page for an example of new information....
|
|||||||||||||||||||||||
mark24 Member (Idle past 5223 days) Posts: 3857 From: UK Joined: |
quote: That is correct, you have nucleotide substitutions & insertions, both are known mutation types. Giving a changed, & longer sequence. So, do we agree new information is possible as a result of mutations, then? Mark ------------------Occam's razor is not for shaving with.
|
|||||||||||||||||||||||
TrueCreation Inactive Member |
I can't find where it makes relevance to something new observably coming about, could you point it out to me? It seems they are talking of how they could have come about from a previous ancestor, not giving an example of this new information coming about.
------------------
|
|||||||||||||||||||||||
TrueCreation Inactive Member |
Is there an example?
------------------
|
|||||||||||||||||||||||
joz Inactive Member |
Are you being deliberately obtuse TC?
|
|||||||||||||||||||||||
mark24 Member (Idle past 5223 days) Posts: 3857 From: UK Joined: |
quote: You provided an example that would mean that new information had been presented. I concur, whether it codes for anything useful is irrelevant to your example. It was a standard set by YOU, not me or Joz. The point is it COULD. Joz has provided you with an example of entire genes being duplicated, mutating, & being useful, to his example I would add myoglobin, that stores oxygen in muscle tissue. Is there an example of point mutations creating new functional protein? Yes.
http://www.nmsr.org/nylon.htm My favorite example of a mutation producing new information involves a Japanese bacterium that suffered a frame shift mutation that just happened to allow it to metabolize nylon waste. The new enzymes are very inefficient (having only 2% of the efficiency of the regular enzymes), but do afford the bacteria a whole new ecological niche. They don't work at all on the bacterium's original food - carbohydrates. And this type of mutation has even happened more than once! Mark ------------------Occam's razor is not for shaving with. [This message has been edited by mark24, 02-08-2002]
|
|||||||||||||||||||||||
KingPenguin Member (Idle past 7911 days) Posts: 286 From: Freeland, Mi USA Joined: |
quote: ---can we all just plz making statements like this. all it does is get us into a bickering war unstead of an actual debate/conversation.
|
|||||||||||||||||||||||
KingPenguin Member (Idle past 7911 days) Posts: 286 From: Freeland, Mi USA Joined: |
quote: there we go again. wooooo sarcasm/jerkism. now im too distracted to even start reading again. ------------------"Overspecialize and you breed in weakness" -"Major" Motoko Kusanagi
|
|||||||||||||||||||||||
joz Inactive Member |
quote: It was a serious question, despite providing exactly the sort of example TC required i was met with an answer of no it isn`t.... I was asking TC in all seriousness whether he was deliberately choosing to gainsay the very evidence he had earlier stated would be relevant.... (added by edit FYI KP I posted proof of 1+1=2 on Mooses thread of the same name last night...) [This message has been edited by joz, 02-08-2002]
|
|||||||||||||||||||||||
TrueCreation Inactive Member |
"It was a serious question, despite providing exactly the sort of example TC required i was met with an answer of no it isn`t....
I was asking TC in all seriousness whether he was deliberately choosing to gainsay the very evidence he had earlier stated would be relevant.... (added by edit FYI KP I posted proof of 1+1=2 on Mooses thread of the same name last night...)"--This wasn't what I was really doing, I was actually trying to push the converstion, I was asking you what in there talks of an observed example of new information, I find the link that mark24 gave me very interesting, I wish I was a biologist, but I'll have to look at some stuff before I am able to reply to it. But what I asked you Joz is what is the example they state? I am trying to push the conversation, not stop it with 'well that isn't what I am looking for' I won't make such an assertion definantly as of yet. ------------------
|
|||||||||||||||||||||||
TrueCreation Inactive Member |
"You provided an example that would mean that new information had been presented.
I concur, whether it codes for anything useful is irrelevant to your example. It was a standard set by YOU, not me or Joz. The point is it COULD. Joz has provided you with an example of entire genes being duplicated, mutating, & being useful, to his example I would add myoglobin, that stores oxygen in muscle tissue."--I am not against the biological mutation as there being possibly beneficial, I find this not as a fallacy in creationist material, but a neccessity. "Is there an example of point mutations creating new functional protein? Yes.
http://www.nmsr.org/nylon.htm My favorite example of a mutation producing new information involves a Japanese bacterium that suffered a frame shift mutation that just happened to allow it to metabolize nylon waste. The new enzymes are very inefficient (having only 2% of the efficiency of the regular enzymes), but do afford the bacteria a whole new ecological niche. They don't work at all on the bacterium's original food - carbohydrates. And this type of mutation has even happened more than once!"--I found the article very interesting, I also found this, I quote form an AiG rebutal towards an e-mail they received regarding nylon digesting bacterium: AiG - That depends on what your definition of information is - http://www.answersingenesis.org/home/area/feedback/negative7-24-2000.asp [QUOTE]
Finally, Mr Cerutti is out of date about this new nylon digesting ability allegedly from a frame shift. New evidence shows that the ability was due to plasmids --Unfortunatelly I can't locate the reading they sighted so wouldn't be able to get more information regarding it, but I found this quote interesting.--Also note, I am wishing I were more knowledgable in the biological field, because I am almost positive that this is going to bring in a considerably molecular biological debate, thus involving my intelligence on the subject, I'll go to the best of my ability though. ------------------ [This message has been edited by TrueCreation, 02-09-2002]
|
|
|
Do Nothing Button
Copyright 2001-2023 by EvC Forum, All Rights Reserved
Version 4.2
Innovative software from Qwixotic © 2024