|
Register | Sign In |
|
QuickSearch
Thread ▼ Details |
|
|
Author | Topic: The End of Evolution By Means of Natural Selection | |||||||||||||||||||||||||||||||||||||||||||
Dr Adequate Member (Idle past 311 days) Posts: 16113 Joined:
|
I honestly don't have a problem with Faith. I agree that she doesn't know enough about genetics to support her grandiose claims, and that her arguments suffer from this, but her perspective on the issue seems perfectly reasonable to me, given her background. But that's exactly what I find so objectionable. She's talking about a subject that she knows nothing about, because she's never bothered to study it. And she must know that she's never bothered to study it, this isn't something that one could simply be mistaken about. So she can only hope to ever be right about anything she says by pure accident. It's so irresponsible. Suppose I flipped a coin to decide whether or not to accuse you of murder ... arson ... rape ... child abuse ... and so forth. Now, I wouldn't know for certain that I was wrong every time the coin came up heads, but on what grounds could I believe that I was right? If that isn't bearing false witness, what is?
|
|||||||||||||||||||||||||||||||||||||||||||
Taq Member Posts: 10073 Joined: Member Rating: 5.2
|
Faith's argument reminds me of an idea I had when I was a child. I thought that if I stood on a rope and then pulled up on the ends of the rope I could make myself levitate. I just couldn't figure out why it wouldn't work. I knew I could lift my own weight. I was baffled.
Of course the solution is quite obvious now. I was ignoring the opposite force created when I pulled on the rope. Faith is making this same mistake. She is ignoring the opposite force in selection, the creation of new alleles by random mutation. To use a different analogy, Faith might as well argue that it should have stopped raining years ago given the limited amount of water the atmosphere can hold all the while ignoring the process of evaporation. Edited by Taq, : No reason given.
|
|||||||||||||||||||||||||||||||||||||||||||
nwr Member Posts: 6411 From: Geneva, Illinois Joined: Member Rating: 4.9 |
Dr Adequate writes:
Clearly, you are not understanding how a Young Earth Creationist thinks.
She's talking about a subject that she knows nothing about, because she's never bothered to study it. And she must know that she's never bothered to study it, this isn't something that one could simply be mistaken about.
|
|||||||||||||||||||||||||||||||||||||||||||
Dr Adequate Member (Idle past 311 days) Posts: 16113 Joined: |
Clearly, you are not understanding how a Young Earth Creationist thinks. I think that that's exactly how a Young Earth Creationist thinks. And I use the word "thinks" in the loosest possible sense. What's your point?
|
|||||||||||||||||||||||||||||||||||||||||||
nwr Member Posts: 6411 From: Geneva, Illinois Joined: Member Rating: 4.9 |
The YEC believe that they have a direct pipeline to the truth, and therefore potentially know more than mere experts.
|
|||||||||||||||||||||||||||||||||||||||||||
Taq Member Posts: 10073 Joined: Member Rating: 5.2 |
The YEC believe that they have a direct pipeline to the truth, and therefore potentially know more than mere experts. It might be something a little different than that. Faith has openly admitted that she is trying to falsify Evolution. The experts are doing something quite different. The experts are trying to build a model that accurately portrays how reality works. Presumably, if Faith follows a path of evidence that leads to the conclusion "Evolution is true" then she must stop, retrace her steps, and try again. What Faith is trying to do is find some path that leads to "Evolution not true".
|
|||||||||||||||||||||||||||||||||||||||||||
Blue Jay Member (Idle past 2724 days) Posts: 2843 From: You couldn't pronounce it with your mouthparts Joined: |
Hi, Dr A.
Dr Adequate writes: She's talking about a subject that she knows nothing about, because she's never bothered to study it. She seems to have done at least some study of it, from what I can tell. Probably not as much as she thinks she has, sure, but I don't think it's fair to expect her to shut up until she has fulfilled all of our requirements. Let's face it, a general fact of science is that none of us actually knows as much as we should or could about the things we study. That's the reason we study them. And, my experience so far has been that making stupid arguments to people who know better while not realizing how stupid your arguments really are is an expected part of graduate education in the biological sciences. As far as I'm concerned, it should be an expected part of this debate, as well. Other than annoying the crap out of you (which really isn't that much of an accomplishment, by the way), she hasn't really done any harm. She seems intelligent enough to be worth the effort, and she's actually made some good insights insofar as her initial assumptions allow. I'm optimistic about the Great Debate topic. I doubt I'll ever convince her that evolution is correct, but I think I've already made a little progress toward helping her understand where the arguments come from and why they make sense. -Bluejay (a.k.a. Mantis, Thylacosmilus) Darwin loves you.
|
|||||||||||||||||||||||||||||||||||||||||||
Dr Adequate Member (Idle past 311 days) Posts: 16113 Joined: |
She seems to have done at least some study of it, from what I can tell. Probably not as much as she thinks she has, sure, but I don't think it's fair to expect her to shut up until she has fulfilled all of our requirements. She's talking about genetics and she doesn't even know what "mutation" means. For pity's sake. If she's really that ignorant about genetics, and if she hasn't been bothered to learn even the basic vocabulary of genetics, then it is contemptible that she should presume to lecture other people on the subject of genetics, a subject which, as she must know perfectly well, she has never bothered to study even in its most basic aspects. Edited by Dr Adequate, : No reason given.
|
|||||||||||||||||||||||||||||||||||||||||||
Faith  Suspended Member (Idle past 1471 days) Posts: 35298 From: Nevada, USA Joined: |
She's talking about genetics and she doesn't even know what "mutation" means. Not having a grasp of the whole process doesn't mean that I don't know that mutation refers to various ways parts of the DNA strand are switched around during duplication.
|
|||||||||||||||||||||||||||||||||||||||||||
Dr Adequate Member (Idle past 311 days) Posts: 16113 Joined: |
Not having a grasp of the whole process doesn't mean that I don't know that mutation refers to various ways parts of the DNA strand are switched around during duplication. No, that would be recombination. I explained to you what "mutation" means and you didn't understand what it was even after I explained it to you.
|
|||||||||||||||||||||||||||||||||||||||||||
Wounded King Member Posts: 4149 From: Cincinnati, Ohio, USA Joined: |
And, my experience so far has been that making stupid arguments to people who know better while not realizing how stupid your arguments really are is an expected part of graduate education in the biological sciences. If you expect to still be making the same stupid arguments after 5 years with no better understanding then your graduate program must really suck. It isn't Faith's argument that people object to, it is that we went through exactly the same farrago of nonsense previously. She's had at least 5 years to actually find out what mutations are, and at least 2 threads opened specifically for her to do so. The fact that she still doesn't seem to understand really can't be put down to anything more than that she doesn't wish to understand because understanding the process of mutation totally invalidates her whole premise. TTFN, WK
|
|||||||||||||||||||||||||||||||||||||||||||
Faith  Suspended Member (Idle past 1471 days) Posts: 35298 From: Nevada, USA Joined: |
I didn't spend the last five years studying evolution, of course, but I did do quite a bit of it, WK, read Dawkins books, read Jerry Coyne's book, listened to a lot of Dawkins on You Tube, mostly his atheism though, but also his blind watchman bit with the computer biomorphs model, looked up tons of stuff and printed it out from various science sites as well as Wikipedia.
In all that I've simply been more convinced of what I'm trying to say here. Sorry about that, but nothing has changed my mind about it. Bluejay thinks he can, Cosmic Chimp linked a lecture at You Tube I still haven't had time to listen to, and I'm willing to see if they can show me where I'm wrong. But I've got to be SHOWN, just screaming at me that I'm ignoring mutations isn't going to do it. I have a rough idea of mutation although it's complicated and I'm not terribly interested in it and don't see its relevance for what I'm talking about. I've seen all those little diagrams of pieces of DNA being switched around in gene duplication, put in different places, turned upside down or whatnot. I'm aware it's considered a mistake in that process. All I need to know about mutation is that according to you all it is the source of alleles. So I have to keep allowing for the possibility that the alleles I'm talking about are mutations. I've been doing that. But I simply don't see its relevance for the project I'm involved in here. Sorry, I don't. I guess you're going to browbeat me about how I should until I just go away, but if I do it will be with the same opinion I arrived with, probably more solidly entrenched. Edited by Faith, : No reason given.
|
|||||||||||||||||||||||||||||||||||||||||||
Taq Member Posts: 10073 Joined: Member Rating: 5.2 |
Not having a grasp of the whole process doesn't mean that I don't know that mutation refers to various ways parts of the DNA strand are switched around during duplication. Here are the four general types of mutation with the parent DNA on top and the offspring DNA on the bottom: Point mutation: AATTGGCCACTTGGCC Insertion: AATTGGCCAACTTGGCC Deletion: AATTGGCCATTGGCC Duplication: AATTGGCCAATTGGCCAATTGGCC Insertions and deletions (often described by a single term "indel) can involve numerous bases. Duplications can be of a whole gene or part of a gene, or a duplication of non-coding DNA. Edited by Taq, : No reason given.
|
|||||||||||||||||||||||||||||||||||||||||||
Percy Member Posts: 22492 From: New Hampshire Joined: Member Rating: 4.9 |
I again suggest you focus your energies on the Reduction of Alleles by Natural Selection (Faith and ZenMonkey Only) thread.
--Percy
|
|||||||||||||||||||||||||||||||||||||||||||
Taq Member Posts: 10073 Joined: Member Rating: 5.2 |
In all that I've simply been more convinced of what I'm trying to say here. Sorry about that, but nothing has changed my mind about it. What evidence, if found, would change your mind?
I have a rough idea of mutation although it's complicated and I'm not terribly interested in it and don't see its relevance for what I'm talking about. If you want to claim that evolution can only reduce variation then you should be interested in evolutionary mechanisms which increase variation. Mutations increase variation. The reason that descendants are different from ancestors is because mutations change the DNA in each generation. Populations that no longer interbreed will accumulate different mutations over time resulting in species that are different.
But I simply don't see its relevance for the project I'm involved in here. Cant' see the relevance, or refuse to see the relevance? That's the question. ABE: Percy wants you to respond in the other thread so only respond to my post if you have time. Admins, please feel free to delete my message if it is a problem. You have my permission. Edited by Taq, : No reason given.
|
|
|
Do Nothing Button
Copyright 2001-2023 by EvC Forum, All Rights Reserved
Version 4.2
Innovative software from Qwixotic © 2024