Problems with evolution? Submit your questions.

By a rational metric I mean some actual formula or calculation that can be used to repeatably measure the information content of a genome/sequence such that 2 independent people could get the same result when performing an analysis of the same genome/sequence. I did finish the sentence you just seem unfamiliar with the parenthetical use of the comma. Without my parenthetical interjection "as in actually measure not just say 'wow that looks pretty complex, I bet god did it'" the original phrase would be "an actual answer to the question of how to measure the informational content of a genome or sequence of DNA."You still aren't providing any such measure and Michael Polanyi certainly didn't have one. None of these are suitable. Nucleotide content, which normally means the ratios of the different nucleotides so I'll assume that is what you meant, can tell you something about a stretch of DNA but it is by no means a measure of information in any standard sense.Similarly 'coding densities' tell us something about the composition of the genome, but they don't tell us about its informational content, just how the coding sequences are distributed. It also ignores the fact that a lot of functional elements are well characterised which are not within protein coding sequences (Taft et al, 2007).Total functional DNA sequences, seems reasonable as a starting point but is a damn hard thing to actually measure and you still have to decide how to use it for comparing genomes. Is the proportion of functional sequences the important thing, or the total number of nucleotides in a functional seuqence, or the number of critical functional nucleotides without which the sequence will lose its function? Is a 'functional density' measure perhaps a better approach?As to 'complexity' that is almost as problematic to measure as information. Are we talking kolmogorov complexity or some other formalised mathematical approach?Some of those things may serve as the basis for a useful informational metric, but just thrown out like that they are virtually useless. As I just said above, complexity is not itself a straightforward measure. Certainly in what might be termed 'morphological complexity', the organisation of a collection of cells as part of one organism a human with billions of cells is clearly more complex than an amoeba's one.If we look at the genomic level then things get more complicated. Many amoebae have much larger genomes than humans, up to 100s of times as large (Ref). Humans have much more in terms of regulatory genetic mechanisms though with hundreds of transcription factors and extensive non-coding regulatory sequences.So in terms of gentic complexity there is no one simple answer, depending on how one chooses to measure it the answer may be either, which is why specifying how you are choosing to measure either information or complexity is so important if we want to actually be talking about the same thing. I don't believe I did, but certainly you haven't put them forward in a way that would actually tell anyone how they could be reliably used to measure information content in a genome/sequence. From different sources. Some amino acids are taken from the external environment, in humans there are a number of such 'essential' amino acids. Some amino acids, the 'non-essential' ones, are synthesised within the cell from other compounds. Having been synthesised or extracted the amino acids stay in the cell cytoplasm until they are recruited by tRNA for protein synthesis. No, I'm just telling you what science has actually found.While you continue to refuse to offer up some usable measure of genetic information/complexity it is virtually impossible to demonstrate an increase in same because what we think is a good example may not fit your own vague criteria.TTFN,WK

Others had beaten it to death. No need to pile onEdited by Theodoric, : No reason given.

---

Facts don't lie or have an agenda. Facts are just facts

What does being adopted have to do with anything on this board? Is there a stigma you you feel adopted people should have? You have a problem with people that are adopted and people that adopt?Listen asshole. If you can not keep the debate to the subject move along. You want to have a debate on adoption and adoptees bring it on. Until then keep to the subject of the debates or shut your fucking mouth.Edited by Theodoric, : No reason given.

---

Facts don't lie or have an agenda. Facts are just facts

Hi, Dennis. Actually, it’s a Free for All thread, even though we’ve been treating it like a science thread: that’s why nobody is stepping in to stop us from mocking each other so blatantly. In a real science thread, we’d have had moderators stepping in telling us to cool it down, and maybe suspending a few of us, by now.But, I’m confused as to why you think my arguments are just opinions about your beliefs. All I have done is present pretty good evidence that your argument is not internally consistent, which is more than enough to topple it on logical or scientific grounds. Your only response so far has been to get annoyed with me and accuse me of being confrontational.I really don’t like offending or irritating people. So, what, exactly, can I do that you won’t take as a personal insult?----- I have kept up with your and Dr A’s discussion up until this point quite well, Dennis. And, my point still stands.With Dr A, you argue that there is some importance to the arrangement of letters and coherence of a message in determining its information content.Then, you get upset with me and accuse me of not keeping up with the discussion when I say that you argue that there is some importance to the arrangement of letters and coherence of a message in determining its information content.What the hell?Do you, or do you not, think that the arrangement of nucleotides is part of the definition of genetic information? Your argumentation so far suggests that you do think this is the case, but you only ever seem to get upset when I ask you about it, and I'm left trying to put together the indirect clues that you're leaving behind in your responses to me and to others on this thread.If you do include arrangement of nucleotides in your definition of "information," how do you measure the arrangement, and how do you determine whether or not a particular arrangement contains more information than another particular arrangement? Surely not by nucleotides or teaspoons?----- There have been at least two or three examples of bacteria evolving antibiotic resistance given in this thread. At least two of them cannot be credibly explained by HGT. In fact, I already made this point in Message 167, but you have not yet responded to it. I assume it just got lost in the swarm, which is understandable and not really offensive to me. Even so, I would still like you to account for this before you continue to assert and/or imply that HGT is how it all went down, as you have been doing.My example (Hallett and Maxwell 1991) was demonstrated to be a random point mutation (an A replaced with a G), and not an HGT event. It was a random change in nucleotide arrangement that had an advantageous (and no apparent deleterious) effect on the bacteria’s fitness.So, this is why I’m asking you whether or not the arrangement of nucleotides in the DNA is part of genetic information.If it is, I have just shown you an increase in genetic information, and, consequently, macroevolution by means of random mutation, and have thus just defeated your argument here.

---

-Bluejay (a.k.a. Mantis, Thylacosmilus)Darwin loves you.

How about providing those statistics.

---

Facts don't lie or have an agenda. Facts are just facts

quote:

---

But in post 233, you said that this genetic damage and incorrect sequencing was the very definition of "genetic loss".

---

Genetic loss would be any sequence of dna that has been changed in any way that renders chemically useless nucleotide arrangements. These are just examples of these, which is what I thought you wanted.

quote:

---

Got that? You say that "errors during transcription" constitute incorrectness and/or damage

---

I also said others. I was offering up examples of genetic loss...what is the problem? Do you need ALL causes of genetic loss to prove that genetic loss can happen? It's obvious that this does happen, and is a documented scientific fact. I'm not sure what you want exactly...

quote:

---

Right, but if I use that terminology, you would have attacked my word choice...

​

No.

---

Oh, well then mutation.

quote:

---

I then pointed out that by doing experiments with clonal lines, we can demonstrate that such resistance does arise by mutation without HGT being implicated or indeed possible.

---

I'm confused, are you saying that HGT is the source for the origin of new information? Or random mutation passed within families of specific organisms...because I already talked quite a bit about how HGT handicaps the organism in most cases...And can I have the link again for the experiments on clonal lines?? I want to read it again. Or was that the E. Coli experiment you quoted earlier?

I had the impression that you were saying that all transcription errors were genetic loss. If you just mean those that cause a gene to cease functioning, that would be quite reasonable. No, it's just a way of passing it around. But you said that HGT of antibiotic resistance was a "genetic gain". I couldn't be bothered to look through the thread, so I googled for another one. This was done on a clonal line of yeast. References are: Francis, J.E., & Hansche, P.E. (1972) Directed evolution of metabolic pathways in microbial populations. I. Modification of the acid phosphatase pH optimum in Saccharaomyces cervisiae. Genetics, 70: 59-73.

​

Francis, J.E., & Hansche, P.E. (1973) Directed evolution of metabolic pathways in microbial populations. II. A repeatable adaptation in Saccharaomyces cervisiae. Genetics, 74:259-265.The experiments are described here. Note the twist at the end (after 800 generations) --- I think it's amusing: Now, as you can see, they started with a single individual --- just one cell of yeast. Hence there is no possibility of the relevant genes merely being passed around by HGT before arising by mutation.

The original papers are freely available(here and here(PDFs)) as is the third one ... Its interesting to note that even though they say that the same mutations ocurred in the precis on the site you linked to the actual papers make it clear that they think the specific mutations are different although they give rise to similar, though not identical, traits.TTFN,WK

Hi, Dennis. Okay, so you're using sort of a functional definition?So, maybe you're thinking of "macro-" and "microevolution" like this: Macroevolution = Making working genes from non-functional DNA
Microevolution = Making genes that work stop working or work differently?So, you want us to provide an example of DNA that doesn't have any useful function being changed by random mutation into DNA that has a useful function?If this is your argument, I'll have to adjust my strategy from here on. So, I'll wait until you confirm, reject or modify my conclusions before I continue.

---

-Bluejay (a.k.a. Mantis, Thylacosmilus)Darwin loves you.

Did you read the link I sent you or even address the point I was making? I hope you are aware that there are more than one type of experiments that can be done with E. coli (for example I am currently using them in work that deals wholeheartedly with feces).The experiment showed this:-There were point mutations.
-12% of these point mutations were beneficial, allowing them to metabolize maltose.
-The ability to use maltose as NRG was novel (ie. NEW!!!) to the progenitor.
-it can be said that genes which code for proteins that help catabolic processes possess information
-since the ability to use maltose was new, it can be called new informationAlso what the heck:"Humans would have been able to eat small rocks in the past (though it wouldn't have provided any nutritional value). The appendix provides a pouch off the main intestinal tract, in which cellulose can be trapped and be subjected to prolonged digestion. Though in humans, the appendix is shrinking, in the past it would have produced cellulose strong enough to eat raw meat, and quite easily digest small rocks."You simultaneously sidestepped my scenario (where they use rocks for energy) by throwing in this totally irrelevant piece of information (except possibly to show that you will agree that humans have evolved).Edited by abrown9, : No reason given.

Hi, dennis780.I realise that you're nervous about discussing things with me since I pointed out that you didn't know the difference between one mutation and 600 mutations.However, I'm still happy to help you in your earnest request for examples of new information.You'll find this review interesting, as it will help you understand some ways in which new information is produced resulting in phenotype novelty, and how the complexity of genomes can increase easily by mutation. Gene duplication and evolutionary novelty in plants - Lex E. Flagel, Jonathan F. Wendel

You'll be lucky, mate. I'm just posting to say welcome to EvC, and yes, of course, your link showed what Dennis claims he's looking for, but always fails to see.

Since we have someone touting their information detection skills, I was wondering if one of you could answer this question.Which one of the following DNA sequences carries the most information, and why:1) AATCGGTTATTAAACCGAAA2) TTGAATACGGTATTGATTTTTOnce you pick out the DNA sequence with the most information of the two, please show me what the sequence looks like once information has either been added or taken away from that sequence, and how you determined the loss and the gain in information.Thank you.

Hi, Taq.It's a trick question: since neither contains a stop codon, both of them have infinite information content. (it is a free-for-all thread)

---

-Bluejay (a.k.a. Mantis, Thylacosmilus)Darwin loves you.

Functional open reading frames only comprise 3% or so of the human genome, yet IDer's claim that the entire genome contains information.