Understanding through Discussion


Welcome! You are not logged in. [ Login ]
EvC Forum active members: 78 (8896 total)
Current session began: 
Page Loaded: 03-24-2019 10:58 AM
52 online now:
dwise1, edge, PaulK, Tanypteryx, vimesey (5 members, 47 visitors)
Chatting now:  Chat room empty
Newest Member: WookieeB
Post Volume:
Total: 848,617 Year: 3,654/19,786 Month: 649/1,087 Week: 18/221 Day: 18/36 Hour: 2/1


Thread  Details

Email This Thread
Newer Topic | Older Topic
  
Prev123
4
56
...
23NextFF
Author Topic:   The Common Ancestor?
Blue Jay
Member (Idle past 776 days)
Posts: 2843
From: You couldn't pronounce it with your mouthparts
Joined: 02-04-2008


Message 46 of 341 (583467)
09-27-2010 2:41 PM
Reply to: Message 44 by barbara
09-27-2010 2:22 PM


Re: Bad Analogies = Bad Science
Hi, Barbara.

barbara writes:

I agree that "common ancestry" should not be used since it is too messy and it is based on speculation. The geographical environmental gene pool that defines a specific ecosystem is the primary initiator for evolution to take over for changes in appearances of the biota over time. That is a better explanation.

Common ancestry means two organisms share an ancestor.

Wherever there is reproduction, there is common ancestry.
Wherever there is evolution, there is common ancestry between species.

It's pretty simple, it isn't messy, and it isn't based on speculation.

The only thing that's messy is identifying which organisms are common ancestors for which other organisms.


-Bluejay (a.k.a. Mantis, Thylacosmilus)

Darwin loves you.


This message is a reply to:
 Message 44 by barbara, posted 09-27-2010 2:22 PM barbara has not yet responded

  
nwr
Member
Posts: 5585
From: Geneva, Illinois
Joined: 08-08-2005


Message 47 of 341 (583468)
09-27-2010 3:10 PM
Reply to: Message 43 by Jon
09-27-2010 12:49 PM


The most recent common ancestor
Jon writes:
But this ape also has ancestors. Why stop at the ape? Why not keep going further back?

Usually, it is the most recent common ancestor that is of interest.
This message is a reply to:
 Message 43 by Jon, posted 09-27-2010 12:49 PM Jon has responded

Replies to this message:
 Message 53 by Jon, posted 09-27-2010 7:39 PM nwr has responded

  
Taq
Member
Posts: 7673
Joined: 03-06-2009
Member Rating: 2.6


Message 48 of 341 (583469)
09-27-2010 3:14 PM
Reply to: Message 38 by barbara
09-26-2010 11:18 PM


Re: Deletions
How do you know it was deleted if it is no longer there anymore? The same question for insertions, how do you know that it wasn't always there in a genome sequence?

You can use a third species such as the gorilla. Even without a third species you can tell that DNA has either been deleted in one lineage or added in another because of the homology on either side of the indel. For example, below is a mock comparison of random sequence. Indels are marked by dashes:


Human
AAATTGTTGCCG---ATGCCCCAGTTGT
AAATTGTTGCCGTTCATGCCCCAGTTGT
Chimp

Whether the TTC was deleted in the human lineage or inserted in the chimp lineage can not be determined by this comparison alone which is why it is called an indel (insertion and deletion combined). However, if we add the gorilla sequence we can learn more:

Human
AAATTGTTGCCG---ATGCCCCAGTTGT
AAATTGTTGCCGTTCATGCCCCAGTTGT
Chimp
Gorilla
AAATTGTTGCCG---ATGCCCCAGTTGT

From this comparison we can determine that the TTC was inserted in the chimp lineage.


This message is a reply to:
 Message 38 by barbara, posted 09-26-2010 11:18 PM barbara has responded

Replies to this message:
 Message 60 by barbara, posted 09-28-2010 1:44 AM Taq has not yet responded

  
Taq
Member
Posts: 7673
Joined: 03-06-2009
Member Rating: 2.6


Message 49 of 341 (583470)
09-27-2010 3:18 PM
Reply to: Message 41 by Strongbow
09-27-2010 9:33 AM


Re: Definitions & Feel-good Science
hat is on possible definition of species, but not comprehensive, and maybe not even accurate.

The important concept here is gene flow. Whether or not two species can produce fertile offspring is not important. What is important is do they produce fertile offspring when given the chance. What we want to know is if mutations can flow freely from one population to the other. If not, then the populations are diverging.

Of course, this definition only applies to living species who reproduce sexually. This doesn't apply to things such as fossil species or bacteria.


This message is a reply to:
 Message 41 by Strongbow, posted 09-27-2010 9:33 AM Strongbow has responded

Replies to this message:
 Message 51 by Strongbow, posted 09-27-2010 3:50 PM Taq has not yet responded

  
Taq
Member
Posts: 7673
Joined: 03-06-2009
Member Rating: 2.6


Message 50 of 341 (583471)
09-27-2010 3:21 PM
Reply to: Message 44 by barbara
09-27-2010 2:22 PM


Re: Bad Analogies = Bad Science
I agree that "common ancestry" should not be used since it is too messy and it is based on speculation.

I disagree. The term "common ancestry" should be used correctly. Also, common ancestry is not based on speculation. It is based on evidence.


This message is a reply to:
 Message 44 by barbara, posted 09-27-2010 2:22 PM barbara has not yet responded

  
Strongbow
Junior Member (Idle past 2988 days)
Posts: 26
Joined: 09-16-2010


Message 51 of 341 (583476)
09-27-2010 3:50 PM
Reply to: Message 49 by Taq
09-27-2010 3:18 PM


Re: Definitions & Feel-good Science
quote:
The important concept here is gene flow. Whether or not two species can produce fertile offspring is not important. What is important is do they produce fertile offspring when given the chance. What we want to know is if mutations can flow freely from one population to the other. If not, then the populations are diverging.

Of course, this definition only applies to living species who reproduce sexually. This doesn't apply to things such as fossil species or bacteria.

hat is on possible definition of species, but not comprehensive, and maybe not even accurate.

The important concept here is gene flow. Whether or not two species can produce fertile offspring is not important. What is important is do they produce fertile offspring when given the chance. What we want to know is if mutations can flow freely from one population to the other. If not, then the populations are diverging.

Of course, this definition only applies to living species who reproduce sexually. This doesn't apply to things such as fossil species or bacteria.


I agree, of course. In fact, I REALLY agree. But the point I was trying to make is that many creationists, or just the scientifically illiterate try to build arguments about precise, legalistic definitions of species.


This message is a reply to:
 Message 49 by Taq, posted 09-27-2010 3:18 PM Taq has not yet responded

    
Jon
Inactive Member


Message 52 of 341 (583500)
09-27-2010 6:48 PM
Reply to: Message 45 by Strongbow
09-27-2010 2:31 PM


SCOTUS Ruling Tactics = Bad Analogies
A species is a bit like pornography...

Really? Or are you just saying that because some judge dude did and you thought it'd be cool to repeat?

Jon


"Can we say the chair on the cat, for example? Or the basket in the person? No, we can't..." - Harriet J. Ottenheimer

"Dim bulbs save on energy..." - jar


This message is a reply to:
 Message 45 by Strongbow, posted 09-27-2010 2:31 PM Strongbow has responded

Replies to this message:
 Message 55 by Strongbow, posted 09-27-2010 8:24 PM Jon has responded

  
Jon
Inactive Member


Message 53 of 341 (583513)
09-27-2010 7:39 PM
Reply to: Message 47 by nwr
09-27-2010 3:10 PM


Re: The most recent common ancestor
Indeed, and it is the time aspect that confuses me. How far back do we go to look for a common ancestor? What is recent? If we go back too far, then we risk getting something that is not representative of the population we want to examine (i.e., something that is not recent enough), but if we get too recent, we risk settling on a critter (since often our understanding of an entire species comes down to the remains of just a couple individuals) that may show a serious degree of interbreeding despite clear differentiations in the gene pools of the two populations - differentiations that clearly indicate a forming difference between the populations, but not one so severe as to prevent breeding.1 What degree of interbreeding and similarities/differences defines our cutoff?

I'm trying to understand how anthropologists decide what is and is not a common ancestor. Are there some critters which lie in a gray area? Perhaps a good way to help would be for an example. What is the agreed-upon most recent common ancestor - using the term cautiously - for humans and chimpanzees? I've seen some names thrown around here, but maybe we can look at the features and characteristics of these ancestors and compare them to present humans and chimps and ancestral humans and chimps to see how the common ancestor relates to both modern populations and to the populations of its daughter species "shortly after the lineages diverged" (to use phrasing by PaulK).

Perhaps answering Tram's question will answer mine.

Jon
__________
1 I, of course, understand the limits on our abilities to examine the DNA of a remain as old as the latest agreed-upon common ancestor.


"Can we say the chair on the cat, for example? Or the basket in the person? No, we can't..." - Harriet J. Ottenheimer

"Dim bulbs save on energy..." - jar


This message is a reply to:
 Message 47 by nwr, posted 09-27-2010 3:10 PM nwr has responded

Replies to this message:
 Message 54 by nwr, posted 09-27-2010 8:18 PM Jon has acknowledged this reply
 Message 75 by Taq, posted 09-28-2010 12:08 PM Jon has responded

  
nwr
Member
Posts: 5585
From: Geneva, Illinois
Joined: 08-08-2005


Message 54 of 341 (583520)
09-27-2010 8:18 PM
Reply to: Message 53 by Jon
09-27-2010 7:39 PM


Re: The most recent common ancestor
Jon writes:
I'm trying to understand how anthropologists decide what is and is not a common ancestor.

I would guess that there is usually some uncertainty.

Hopefully, somebody with more knowledge of the field will be able to comment.


This message is a reply to:
 Message 53 by Jon, posted 09-27-2010 7:39 PM Jon has acknowledged this reply

  
Strongbow
Junior Member (Idle past 2988 days)
Posts: 26
Joined: 09-16-2010


Message 55 of 341 (583522)
09-27-2010 8:24 PM
Reply to: Message 52 by Jon
09-27-2010 6:48 PM


Re: SCOTUS Ruling Tactics = Bad Analogies
quote:
Really? Or are you just saying that because some judge dude did and you thought it'd be cool to repeat?


Jeez...a little touchy eh?

I meant only that it's sometimes difficult to draw a bright line between species, because it's more of a descriptive concept than a definitive set of criteria.

In the same way , it's sometimes difficult to draw a bright line between provacative, but legitimate sexually-themed art and porno.

If that's too hard to follow, consider language.... when did Old English become Middle English? When did Middle English become Elizabethan English? When did Elizabethan English morph into Modern English?

The changes are slow, and gradual. I don't think you could define a date where everything before was one thing and everything after another. Species are quite similar in that respect.


This message is a reply to:
 Message 52 by Jon, posted 09-27-2010 6:48 PM Jon has responded

Replies to this message:
 Message 56 by Strongbow, posted 09-27-2010 8:26 PM Strongbow has not yet responded
 Message 59 by Jon, posted 09-27-2010 10:51 PM Strongbow has responded

    
Strongbow
Junior Member (Idle past 2988 days)
Posts: 26
Joined: 09-16-2010


Message 56 of 341 (583524)
09-27-2010 8:26 PM
Reply to: Message 55 by Strongbow
09-27-2010 8:24 PM


Re: SCOTUS Ruling Tactics = Bad Analogies
Common ERV's an excellent way to determine common ancestors, if DNA is available. They allow very detailed evolutionary relationships to be determined.
This message is a reply to:
 Message 55 by Strongbow, posted 09-27-2010 8:24 PM Strongbow has not yet responded

Replies to this message:
 Message 57 by Ken Fabos, posted 09-27-2010 10:02 PM Strongbow has not yet responded
 Message 64 by Dr Adequate, posted 09-28-2010 4:27 AM Strongbow has not yet responded

    
Ken Fabos
Member (Idle past 335 days)
Posts: 51
From: Australia
Joined: 05-09-2010


Message 57 of 341 (583547)
09-27-2010 10:02 PM
Reply to: Message 56 by Strongbow
09-27-2010 8:26 PM


Ancestor in common; yes.
How far back before we all share common ancestors is a genuine question, surely? Within a small population - as the foundation population of our species must have been - the number of generations further back to ancestors in common isn't far. Having a specific individual that all our species can count as an ancestor doesn't seem outrageous to me although it would only be found by studying our genome; finding the physical remains of that individual rather than the continually reproduced dna that came from them isn't going to happen. Isn't the reason a past species has appeared to be supplanted without intervening forms that evolution within groups isolated by geography and perhaps by territorial behaviour, results in more rapid differentiation than within big populations and when it produced traits that made for competitive success and the ability to colonise new territory, the diaspora of a new form (possibly not interfertile and thus species) followed. The prior intermediary forms occurred in relative isolation and in small overall numbers and most places simply don't suit successful fossilisation.
This message is a reply to:
 Message 56 by Strongbow, posted 09-27-2010 8:26 PM Strongbow has not yet responded

Replies to this message:
 Message 58 by Jon, posted 09-27-2010 10:20 PM Ken Fabos has not yet responded

  
Jon
Inactive Member


Message 58 of 341 (583549)
09-27-2010 10:20 PM
Reply to: Message 57 by Ken Fabos
09-27-2010 10:02 PM


Re: Ancestor in common; yes.
Having a specific individual that all our species can count as an ancestor doesn't seem outrageous to me

It seems outrageous to me, and for good reason. Speciation does not show effects in single individuals. It takes an entire population breeding (gene swapping) back and forth generations to bring about changes that create new species out of old ones, and when it does, as the process should tell you, those new traits that can safely be clumped together as characteristics of a new species reside in the population at large, not a specific individual.

evolution within groups isolated by geography and perhaps by territorial behaviour, results in more rapid differentiation than within big populations

Of course this is true, and it is true precisely because evolution works on populations, not individuals.

Jon


"Can we say the chair on the cat, for example? Or the basket in the person? No, we can't..." - Harriet J. Ottenheimer

"Dim bulbs save on energy..." - jar


This message is a reply to:
 Message 57 by Ken Fabos, posted 09-27-2010 10:02 PM Ken Fabos has not yet responded

Replies to this message:
 Message 63 by Dr Adequate, posted 09-28-2010 4:22 AM Jon has not yet responded

  
Jon
Inactive Member


Message 59 of 341 (583559)
09-27-2010 10:51 PM
Reply to: Message 55 by Strongbow
09-27-2010 8:24 PM


Re: SCOTUS Ruling Tactics = Bad Analogies
Easy. I agree with your statements. I just found your explanation funny.

Jon


"Can we say the chair on the cat, for example? Or the basket in the person? No, we can't..." - Harriet J. Ottenheimer

"Dim bulbs save on energy..." - jar


This message is a reply to:
 Message 55 by Strongbow, posted 09-27-2010 8:24 PM Strongbow has responded

Replies to this message:
 Message 65 by Strongbow, posted 09-28-2010 7:31 AM Jon has not yet responded

  
barbara
Member (Idle past 2880 days)
Posts: 167
Joined: 07-19-2010


Message 60 of 341 (583576)
09-28-2010 1:44 AM
Reply to: Message 48 by Taq
09-27-2010 3:14 PM


Re: Deletions
Thanks Taq, that makes sense.
This message is a reply to:
 Message 48 by Taq, posted 09-27-2010 3:14 PM Taq has not yet responded

    
Prev123
4
56
...
23NextFF
Newer Topic | Older Topic
Jump to:


Copyright 2001-2018 by EvC Forum, All Rights Reserved

™ Version 4.0 Beta
Innovative software from Qwixotic © 2019