"Creation Science" experiments.

Hi Just being real. Sorry to come in a little late on this, but in your post where you attempt to construct a creation science experiment you introduce the concept of ‘apc’: Although you don’t give an exact definition of what apc is, in a later post you do subsequently note: My problem is how the examples of apc you give relate to the above concept. In particular the example of the birds nest Please help me here. I can see how the birds nest fits in to your definition of abstruse, but I’m not sure how any nave observer (say an alien) stumbling upon a bird’s nest would be able to discern whether it was particularized or not. I’m also concerned as to how the birds nest fits in to the communication part of apc — how is it exchanging information, and with who / what?I have even more trouble fitting your final example into the apc concept: It is a concern that in order to recognize apc we need to recognize ‘purpose’, when in reality purpose is defined not by our observation of the object, but by watching an intelligence creating or utilising the object (ie the stick had no apc until the chimp picked it up). In the end this all boils down to ‘an object is intelligently designed when we see something intelligent designing it’. Not a very useful definition really.Once again, sorry for coming in late on this, and if you have answered my questions already please just point me in the right direction (at ~350 posts it's hard to wade through all the info here).

Aaa...but you are mistaken my friend. You do have to exercise faith in gravity to hold you to the earth. In fact you do it so much that you do not even think about it. You do not walk around holding on to things that are bolted down to the earth. Why is that? It is because you have faith in your experience and knowledge of gravity. If you thought that at any second it could turn off and you would go floating away, then you would behave differently. By the way that may be the way a lot of people define faith, but in the Christian experience, it is defined a little differently. But without faith it is impossible to please Him, for he who comes to God must believe that He is, and that He is a rewarder of those who diligently seek Him. Heb 11:6Note that this verse describes a person first coming to the understanding that God exists, and then placing their faith in that God, that He will reward those who diligently seek Him. So are we just supposed to have blind faith that God exists? Not at all. The Bible clears that up also. For since the creation of the world His invisible attributes are clearly seen, being understood by the things that are made, even His eternal power and Godhead, so that they are without excuse Romans 1:20In this verse we are told that God's existence can clearly be seen and understood by studying creation. That means by studying the world and universe around us (science) we can come to an understanding that God exists. After we come to that understanding we then must place our "faith" in Him to please Him. So then our faith becomes not as the world defines it, a blind leap into a dark chasm, but it is a faith based on evidence and logic.

I never said they all do. I said they all have a need to. That's not true. Your statement presumes to know the intentions of the designer. Some species could actually be designed to have an abnormally large amount of offspring to "fail" from our view point because they serve a purpose for the survival of other organisms. For example the mosquito lays thousands of offspring because without it a whole ecosystem would collapse. No I think that burden of proof lays upon the one using the study with the "mutated bacteria" as evidence for natural evolution and a mechanism to demonstrate how life could have arrived. Well go right ahead. Knock yourself out. Your the one trying to pass off ecol i bacteria and others as evidence for how life could have arrived and developed to its current advanced state.But I don't have enough "faith" in the bacteria alone to accept the evolutionary hypothesis. But that's just me.

No it only has a complex pattern on its backside. It is not a specified complex pattern. Here again is how I ----->"DEFINED"<----- a foreknown pattern that was completely interdependent of the first. In other words, for an observer to test for specificity, he must be able to recognize it from a completely independent experience. This can either be a pattern that produces a recognition response or a functional response.The pattern on the back of your spider is very interesting but it does not match any other foreknown patterns fulfilling any specific purpose. My thumb print has an equally very interesting pattern, but it does not qualify as being specific.BTW, had your tobacco plant exhibited a change in flowering times do to outside pressures in its own single life span, and then changed back in that same life span when pressures lifted, then yes this would have been evidence that somehow the plant was demonstrating design. But that's not at all what your article said occurred.

No you keep conflating different forms of specified complexity. One is originated by the organism and the other is just a copied reproduction programmed by some other intelligent source. I can sit here and type a complete sentence and that is specified complexity that I originated. But I have no control over my DNA molecules and what types of cells they build. That is specified complexity, but it came from some other intelligent source. Not from me. The bee ORIGINATES the symbolism that correspond to location of a new food source to the other bees in the hive. But the micro-organisms chemical codes are pre-programmed information that originated from somewhere else. When a burglar smashes in the front door of my house it trips a response that dials a pre-programmed number and notifies authorities of a home intrusion alarm. That does not mean the alarm system originated the information. That's nonsense. When SETI searches the night sky for a transmission coming from deep space, in the form of a set of simple prime numbers, they don't need to know anything about who originated the transmission to know that it would require an intelligent source. All I have to do is show that something has specified complexity in order to detect intelligence.

Hi Boof, good to have you joining us. Note that in post 314 I said: "...there is another element to understanding information in DNA. As I pointed out in an earlier post, polymers can also be said to have abstruse information, but they lack particularization or specificity." Specificity is any event or object which exhibits a pattern that matches a foreknown pattern that was completely interdependent of the first. In other words, for an observer to test for specificity, he must be able to recognize it from a completely independent experience. This can either be a pattern that produces a recognition response or a functional response.So specificity may exist, but it just may be that your "aliens" would not yet recognize it. In the case of the nest, the round pattern would of course trigger a "functional" response to the bird, and likewise to any other creature with the ability to understand birds and their nesting patterns. For example the object would be recognized by a snake who knows that it is a good place to look for "bird offspring" as a food source.

Hi JBR,I eagerly await your reply, but I do just have to address this; I never said that. You are the one who dragged origins of life into this. I was talking about evolution, not abiogenesis; they're two separate topics. A study such as Lenski's Cit+ bacteria study has nothing to do with the origins of life, nor have I said that it does.Mutate and Survive

---

"A curious aspect of the theory of evolution is that everybody thinks he understands it." - Jacques Monod

So have you gone wayward on your term "apc", or are you saying it is directly interchangeable with "specified complexity"? If the latter, you are in for a ride because even your buddy Dembski has trouble defending that term, and he friggin coined it.However, if you are now simply using specified complexity, that really changes your experiment, now doesn't it? No one gives a fuck what your defenition for specificity is. You coined a term: "apc". DEFINE THAT. Unless you are giving up on it?

---

"What can be asserted without proof, can be dismissed without proof."-Hitch.

I had already pointed out that JBR's "attempt to define [npc] again more exhaustively" failed.
It didn't even mention the term 'NPC', but instead had passages defining 'specificity'.Since JBR never mentioned his 'definition' again, I took it for granted that he had realised he wasn't able to define it.
Why is it when people are asked for more specificity (pun intended), they get more vague? It reminds me of a conversation I had with a customer service worker:
"How long will it take?"
"I'll put it at the top of my list."
"How long will it take?"
"I should be able to start it today."
"How long will it take?"
"The parts that are required are sourced locally."

​

"Will it take 1 hour?"
"Will it take 2 hours?"
(Not an exaggeration)Edited by Panda, : No reason given.

Yes, but the ONE experiment in this thread is his and is dependent on his term "apc (abstruse particularized communication)". He has, as of yet, neglected to provide a working definition for this. The examples he has given thus far (in Message 257, where he first coined the term and gave his experiment) do not work the same with "specified complexity". Furthermore, even William Dembski, who coined the term "specified complexity", has trouble backing up the term so I doubt if JBR will fair any better.I also find it funny how this thread has divulged into something so...........complex. I initially had the intent to try and see if ID was something that could be studied by a layperson the same as "secular science". Obviously, it can't (unless you accept the "it looks designed, so it must be" argument"). Simply put: there just aren't any workable experiments in accordance with the "theory" of ID.{abe}
Bluegenes has also put forth an experiment, but this thread is so bloody long, I forgot about it. Sorry.Edited by hooah212002, : No reason given.

---

"What can be asserted without proof, can be dismissed without proof."-Hitch.

The production of a termite mound fits which category? You couldn't do it without the "program" in your genome. "Specified complexity" is a prerequisite for all known intelligent designers. You say that your theory is built on observation. It's necessary to include all relevant observations. So you keep saying. You are both designed and designer. But your ability to design things that contain specified complexity cannot explain the origin of specified complexity, because you are dependent on it. A lot of biologists will tell you that the bees are pre-programmed as well. Again, what about the termites building their mounds, and, while we're at it, to what extent are the birds building their nests pre-programmed, and to what extent are they flexible intelligent designers? Agreed. And where does it originate? In the genome of the engineer? In the genomes of his ancestors? Can the engineer design the system without the input of information from his environment; information that has a non-intelligent source?We know that "specified complexity" can produce "specified complexity". That does not tell us what the origin of specified complexity is, though. If specified complexity has an original cause, it would have to be something that does not contain it, by definition.I don't think that intelligent designers are a very good candidate for that cause, do you? But SETI is not looking for the origins of specified complexity, are they? They are looking for beings like us, for whom specified complexity would be a pre-requisite.

I object! I described a very good YEC experiment here. Message 19Many of their hypotheses can be tested.

To repeat myself yet again:JBR, is this ground "designed?" Yes, or no? Does your five-year-old agree?

---

"The wretched world lies now under the tyranny of foolishness; things are believed by Christians of such absurdity as no one ever could aforetime induce the heathen to believe." - Agobard of Lyons, ca. 830 AD

The above statement is immediately followed by . . . Perhaps you should follow your own advice. That is what we are asking you for in this thread: experiments we can run in order to infer the Intelligent Design origin of bacteria. If you want to claim that bacteria are designed then you need to supply the experiments which demonstrate this.If we ran an experiment where mutations conferring antibiotic resistance occurred in the absence of antibiotic would this falsify ID? What experimental results with respect to the modification of DNA would falsify ID? From my reading, the only assertions were related to how each generation is modified from the last generation, not how life originated to begin with.

How did you determine that it was programmed by an intelligent source? So does the following DNA sequence contain specified complexity, and how did you determine this?

GAGGTTAGCCGAAAAAGCACGTGGTGGCGCCCACCGACTGTTCCCAGACTGTAGCTCTTTGTTCTGTCAAGGCCCGACCTTCATCGCGGCCGATTCCTTC