|
Author
|
Topic: Problems with evolution? Submit your questions.
|
Taq
Member Posts: 10084 Joined: 03-06-2009 Member Rating: 5.1
|
|
Message 679 of 752 (607217)
03-02-2011 3:07 PM
|
Reply to: Message 678 by havoc
03-02-2011 3:05 PM
|
|
Re: my karma ran over your dogma
And the finger digits do not so is this evidence against common ancestor or do u pick and choose what you like? Please explain. Also, I am still waiting for you to show us how to measure the specified complexity in that DNA sequence. Working on that yet? Edited by Taq, : No reason given.
| This message is a reply to: | | | Message 678 by havoc, posted 03-02-2011 3:05 PM | | havoc has replied |
| Replies to this message: | | | Message 681 by havoc, posted 03-02-2011 3:38 PM | | Taq has replied |
|
Taq
Member Posts: 10084 Joined: 03-06-2009 Member Rating: 5.1
|
|
|
Message 693 of 752 (607239)
03-02-2011 5:41 PM
|
Reply to: Message 681 by havoc
03-02-2011 3:38 PM
|
|
Re: my karma ran over your dogma
One of the most commonly argued proofs of evolution is the pentadactyl limb pattern, i.e. the five-digit limbs found in amphibians, reptiles, birds and mammals. However, they develop in a completely different manner in amphibians and the other groups. To illustrate, the human embryo develops a thickening on the limb tip called the AER (apical ectodermal ridge), then programmed cell death (apoptosis) divides the AER into five regions that then develop into digits (fingers and toes). By contrast, in frogs, the digits grow outwards from buds as cells divide So the developmental pattern has changed in both lineages, or perhaps changed in only one lineage. Your point? We still see a nested hierarchy, as expected.
Does this cause you to question your belief? If not why does the backbone development count as proof but finger development does not? Can you explain why phalanges and backbones are not homologous structures?
| This message is a reply to: | | | Message 681 by havoc, posted 03-02-2011 3:38 PM | | havoc has not replied |
|
Taq
Member Posts: 10084 Joined: 03-06-2009 Member Rating: 5.1
|
|
|
Message 694 of 752 (607240)
03-02-2011 5:43 PM
|
Reply to: Message 682 by havoc
03-02-2011 3:43 PM
|
|
Re: goalposts on the run.
I never said Shannon was the propper way to measure information in the genome. But you did mention information quite a few times, and now you have switched over to specified complexity. This is called "moving the goal posts".
Any one who studys information theory knows that shannon theory is usefull for somethings but comes short in others. So why is it not useful for determining an information gain or loss in genomes?
| This message is a reply to: | | | Message 682 by havoc, posted 03-02-2011 3:43 PM | | havoc has not replied |
|
Taq
Member Posts: 10084 Joined: 03-06-2009 Member Rating: 5.1
|
|
|
Message 696 of 752 (607242)
03-02-2011 5:47 PM
|
Reply to: Message 689 by havoc
03-02-2011 5:02 PM
|
|
Re: Address posts please
I commented on this and how its design was not flawed and how this was one of the examples of convergent evolution that evos use as a just so explanation of violations of their theory. Where is the violation? We don't see ANY VERTEBRATES with a forward facing retina, including those that share the same ecological niches that cephalopods occupy. The eyes fall into the expected nested hierarchy that the theory of evolution predicts. And I am still waiting for you to measure the specified complexity in the DNA sequence I posted in a previous message.
| This message is a reply to: | | | Message 689 by havoc, posted 03-02-2011 5:02 PM | | havoc has replied |
| Replies to this message: | | | Message 704 by havoc, posted 03-03-2011 8:41 AM | | Taq has replied |
|
Taq
Member Posts: 10084 Joined: 03-06-2009 Member Rating: 5.1
|
|
|
Message 712 of 752 (607374)
03-03-2011 11:21 AM
|
Reply to: Message 704 by havoc
03-03-2011 8:41 AM
|
|
Re: Address posts please
Well that might not be a fair question since I do not know the language of DNA and amino acids. Then how do you know that it contains specified complexity if you can't even measure it?
However since I do so love these discussions I will try to play along. Dembski purposes a filter to determine design or specified complexity. Eliminate regularity resulting from natural law ie: crystal structure or a pulsar wave. Eliminate randomness which is the result of chance. What you are left with is design. These events are both specified and of vanishingly small probabilities. Specified events of small probability do not occur by chance. Then apply the filter to the DNA sequence I posted in the previous message and show me the results.
A question for you, do you doubt that specified complexity exists or do you just reject it because it is not as easily measured as Shannon’s bits? I have yet to see specified complexity applied to DNA sequence in any meaningful way. So far, specified complexity seems to be irrelevant to biology.
| This message is a reply to: | | | Message 704 by havoc, posted 03-03-2011 8:41 AM | | havoc has not replied |
|
Taq
Member Posts: 10084 Joined: 03-06-2009 Member Rating: 5.1
(1)
| |
| |
| |
|
|
Message 713 of 752 (607375)
03-03-2011 11:43 AM
|
Reply to: Message 701 by havoc
03-03-2011 8:09 AM
|
|
Re: shakespeare, mutation AND selection
Do you really not get the correlation between my Shakespeare analogy and novel functional information? You never demonstrated a correlation. You simply asserted one without presenting evidence to back it up. You claim that mutations can not increase information. When pressed to define "information" you moved to "specified complexity". When asked to measure the specified complexity of a DNA sequence you now claim that you can't do it. So how is it that you could claim that mutations can not increase information/SC when you can't even measure it to begin with?
| This message is a reply to: | | | Message 701 by havoc, posted 03-03-2011 8:09 AM | | havoc has not replied |
|
Taq
Member Posts: 10084 Joined: 03-06-2009 Member Rating: 5.1
|
Re: shakespeare, mutation AND selection
I think his problem is the other way round. According to his "filter" answer a mutation by definition does not produce specified complexity, because it's random. This would seem to be a rather large problem in that it makes specified complexity irrelevant to biology. If a random mutation does result in a novel function that is beneficial to the organism it would not qualify as specified complexity. IOW, evolution can produce the biodiversity we see today without needing to increase specified complexity.
But there is a certain amount of ambiguity in the term, one which creationists play with to confuse themselves. Sometimes they talk as if it's a property of the sequence qua sequence, and sometimes as if it's a property of the history of the sequence. This allows them to forget that they haven't actually taken the necessary step of showing that there is any justifiable inference from the present properties of the sequence to their supposed properties of the history of the sequence; but while they have not established that link, they have established a different and factitious link, namely that they themselves are using the same word for both concepts. Such is the consequence of starting with the conclusion. They start with the conclusion that the DNA they observe was designed, therefore any function produced by mutations in this sequence were not specified by the designer and therefore can not be specified complexity. They use definitions to exclude evolution from the process at the very start.
| This message is a reply to: | | | Message 715 by Dr Adequate, posted 03-03-2011 12:49 PM | | Dr Adequate has not replied |
|
Taq
Member Posts: 10084 Joined: 03-06-2009 Member Rating: 5.1
|
|
|
Message 745 of 752 (607440)
03-03-2011 5:34 PM
|
Reply to: Message 725 by havoc
03-03-2011 4:20 PM
|
|
Re: et all
I have given you two different ways purposed to measure information content or specified complexity. Then please use one of these methods to measure the information/SC content of this DNA sequence:
quote:
GCGTATCCTATATATTAAGTTAATTCTTATGGAATATAATAACATGTGGATG
GCCAGTGGTCGGTTGTTACACGCCTACCGCGATGCTGAATGACCCGGAC
TAGAGTGGCGAAATTTATGGCGTGTGACCCGTTATGCTCCATTTCGGTCAG
TGGGTCATTGCTAGTAGTCGATTGCATT GCCATTCTCCGAGTGATTTA
I have seen no one point to a better way to measuer it.
We have yet to see you measure information/SC.
| This message is a reply to: | | | Message 725 by havoc, posted 03-03-2011 4:20 PM | | havoc has not replied |
|
Taq
Member Posts: 10084 Joined: 03-06-2009 Member Rating: 5.1
|
|
|
Message 746 of 752 (607441)
03-03-2011 5:35 PM
|
Reply to: Message 737 by havoc
03-03-2011 4:56 PM
|
|
Re: et all
Can you name one code that has no code maker?
I can name many for which there is no known code maker, DNA and electron orbitals being two. If you want to claim that a code requires an intelligence then it is up to you to demonstrate it.
| This message is a reply to: | | | Message 737 by havoc, posted 03-03-2011 4:56 PM | | havoc has not replied |
|
Taq
Member Posts: 10084 Joined: 03-06-2009 Member Rating: 5.1
|
|
|
Message 747 of 752 (607442)
03-03-2011 5:37 PM
|
Reply to: Message 735 by havoc
03-03-2011 4:52 PM
|
|
Re: et all
However an earth quake at the scrabble store will never write a novel.
No one is claiming that they do. We are talking about biology and evolution. Will you be joining this conversation?
| This message is a reply to: | | | Message 735 by havoc, posted 03-03-2011 4:52 PM | | havoc has not replied |
|
™ Version 4.2