Understanding through Discussion


Welcome! You are not logged in. [ Login ]
EvC Forum active members: 85 (8915 total)
Current session began: 
Page Loaded: 07-22-2019 6:11 AM
23 online now:
Heathen (1 member, 22 visitors)
Chatting now:  Chat room empty
Newest Member: 4petdinos
Upcoming Birthdays: anglagard
Post Volume:
Total: 857,297 Year: 12,333/19,786 Month: 2,114/2,641 Week: 69/554 Day: 6/63 Hour: 0/0


Thread  Details

Email This Thread
Newer Topic | Older Topic
  
Prev1
2
3456
...
10Next
Author Topic:   Intelligent Design just a question for evolutionists
Tangle
Member
Posts: 6954
From: UK
Joined: 10-07-2011
Member Rating: 4.9


(1)
Message 16 of 146 (792330)
10-07-2016 6:05 AM
Reply to: Message 1 by mike the wiz
10-06-2016 6:04 PM


MtW writes:

The syllogism I have used for ID, was never meant to be used as a creationist argument, but only as a way to ASCERTAIN if an object or thing, is designed;

If something has the elements of design it is designed. (X is X, Law of identity)
Life has the elements of design
Therefore life is designed.

Despite the fact that it IS a creationist argument and you ARE a creationist - the journalistic principle of 'consider the source' always applies - syllogisms don't prove anything - they're as likely to be invalid as valid. So.....

All animals have 4 legs
A dog has 4 legs
Therefore a dog is an animal

..... turns out by observation to be correct

But...

All elephants have 4 legs
All tables have 4 legs
Therefore all tables are elephants

.....turns out by observation not to be correct

You can't prove anything with words - your syllogism turns out to be nothing more than a weak hypothesis that can only be proven by observation, measurement, testing and experiment. ie science. And science dismisses it. Game over.


Je suis Charlie. Je suis Ahmed. Je suis Juif. Je suis Parisien.

Life, don't talk to me about life - Marvin the Paranoid Android

"Science adjusts it's views based on what's observed.
Faith is the denial of observation so that Belief can be preserved."
- Tim Minchin, in his beat poem, Storm.


This message is a reply to:
 Message 1 by mike the wiz, posted 10-06-2016 6:04 PM mike the wiz has responded

Replies to this message:
 Message 19 by mike the wiz, posted 10-07-2016 6:15 AM Tangle has responded

  
mike the wiz
Member
Posts: 4659
From: u.k
Joined: 05-24-2003


Message 17 of 146 (792331)
10-07-2016 6:05 AM
Reply to: Message 14 by Genomicus
10-07-2016 5:53 AM


Genomicus writes:

No, I said it's a terrible way to detect intelligent design. Sure, you can detect design -- but we need an approach where we can determine if that design is the result of agency or Neo-Darwinian mechanisms.

Why? Do we need an approach so as to determine whether a cake was baked or whether the theory it baked itself, done it?

You are muddying-the-water. When we examine whether something is intelligently designed, we can 100% know the features of design because we can examine things we already know to be designed. That's the first step.

Secondly, we can also tangibly examine the object-in-question to see if it has those features.

HOW CAN WHAT A THEORY SAYS ABOUT THE OBJECT, AFFECT WHETHER IT HAS THOSE FEATURES OR NOT?

According to the law-of-the-excluded-middle, either the object in question qualifies as having the features of intelligent design, or it does not. Because we can DIRECTLY examine it, why would indirect conjecture of a theory, have any weight?

Think about it properly instead of desiring to refute me, as thus far you have shown good honesty.

If someone came up to you and placed a football at your foot, and said, "please tell me is this a football" and you went to examine it and they clicked their fingers and said, "oh hang on a minute, we have a theory this isn't a football, it's brilliant and most people accept the theory by neurotic agreement so forget the examination"

Would that be an intelligent way to proceed, when you have the football in front of you and can simply test whether it is one?

In the same way, I don't need the speculation of evolution-theory to tell me if a rabbit has the features of design, I simply examine it's make-up and see that it does;

- specified complexity
- information
- contingency planning
- correct materials (not metal or enamel for a stomach)
- aesthetics and symmetry
- goals and subgoals
- congruency/integration of systems in union of the overall goal. (eyes, ears used for balance, don't get in each others way, etc..car wheels don't get in the way of the carburetor, etc..it is all a union of corresponding integration).
- information storage density
- directed energy

(Obviously I didn't want to argue intelligent design in this thread but if unfair assertions about my arguments are made, obviously this gives me some leeway, but I would rather not explain it all again, and again and again, coming across the same mistakes by evolutionists, the same mistaken objections that OCCUR to them, and which I already know of, having dealt with those objections for a long, long time).


This message is a reply to:
 Message 14 by Genomicus, posted 10-07-2016 5:53 AM Genomicus has responded

Replies to this message:
 Message 20 by Genomicus, posted 10-07-2016 6:18 AM mike the wiz has not yet responded
 Message 145 by Modulous, posted 01-06-2017 8:26 PM mike the wiz has not yet responded

  
Genomicus
Member (Idle past 140 days)
Posts: 852
Joined: 02-15-2012


Message 18 of 146 (792332)
10-07-2016 6:14 AM
Reply to: Message 9 by dwise1
10-07-2016 1:53 AM


Life Looks Engineered
Now, I have seen a number of creationists try to claim that complexity equals "design". They love to point to all kinds of complexity and, with no reason, proclaim that to be proof of design.

Well, by profession I am an engineer. I do know something about how an engineer works and thinks. An engineer works to reduce complexity. Modular design, creating functional modules that you can plug into anywhere, are very popular.

But that is not what we see in real life.

That's actually exactly what we see in life. They're called "protein domains," and they function as modular parts that give architecture to a diverse array of molecular machines and systems (which, in turn, give form and function to cells).

I see this argument a lot from those with a non-teleological perspective: that life, actually, doesn't look like the product of engineering. But the examples usually cited are not molecular -- they are typically tissue-level or anatomical.

When we go into the realm of molecular biology, the appearance of engineering only strengthens. In short, the more we know about molecular biology, the more the analogy between engineering and the molecular fabric of life deepens.

And that's suspicious. Why does life's molecular fabric look like the product of engineering? Typical arguments about "irrational design" -- like the eye's backward wiring -- simply break down when one considers the structural designs of life's core, phylogenetically basal molecular machinery (e.g., bacterial flagella, F-ATPases, etc.).

And before this is hand-waved away as an improper argument from analogy, remember that analogous reasoning is at the heart of the origin of many robust scientific hypotheses. That's kinda why Margulis' endoysmbiotic hypothesis emerged triumphant and was "almost unchallengeable" by 1974, the protestations of evolutionary biologists Uzzell and Spolsky notwithstanding. Her argument as to the origin of mitochondria was largely based on Wallin's observations concerning the similarities between the cytological properties of mitochondria and bacteria.

Edited by Genomicus, : No reason given.


This message is a reply to:
 Message 9 by dwise1, posted 10-07-2016 1:53 AM dwise1 has not yet responded

Replies to this message:
 Message 21 by mike the wiz, posted 10-07-2016 6:25 AM Genomicus has not yet responded
 Message 27 by Taq, posted 10-07-2016 10:48 AM Genomicus has responded

  
mike the wiz
Member
Posts: 4659
From: u.k
Joined: 05-24-2003


Message 19 of 146 (792333)
10-07-2016 6:15 AM
Reply to: Message 16 by Tangle
10-07-2016 6:05 AM


Tangle writes:

Despite the fact that it IS a creationist argument and you ARE a creationist - the journalistic principle of 'consider the source' always applies - syllogisms don't prove anything - they're as likely to be invalid as valid. So.....

All animals have 4 legs
A dog has 4 legs
Therefore a dog is an animal

..... turns out by observation to be correct

Non-sequiturs can be true in their conclusions, but this argument is either the undistributed middle term, fallacy or affirmation of the consequent, depending on what you meant by "a dog has 4 legs"(in a logical sense),.. so your example is of a fallacious syllogism in support of your argument that syllogisms don't prove anything..

Tangle writes:

But...

All elephants have 4 legs
All tables have 4 legs
Therefore all tables are elephants

.....turns out by observation not to be correct

Again, it is not correct because this time it is the fallacy of the undistributed middle term in which it happens to be a false conclusion.

You still commit the fallacy of the undistributed middle term if your conclusion is false, both your examples are not examples of a sound syllogism, and you claim syllogisms aren't proof but you only give examples of unsound ones.

You gave an example of two syllogisms whereby the form was not valid.

If you want to give an example of a SOUND syllogism, the form has to be valid, and obey the ponen/tollens rules, and the premises have to be true.

So then I disagree with your argument that syllogisms don't prove anything because sound ones can indeed deductively prove things;

All biological pigs are animals.
My pet is a biological pig
Therefore my pet is an animal.

So you have to understand that the form of a syllogism can be wrong even if it's conclusion is accidentally true. A non-sequitur can have a true conclusion but the conclusion still does not follow from the premises.

Edited by mike the wiz, : No reason given.


This message is a reply to:
 Message 16 by Tangle, posted 10-07-2016 6:05 AM Tangle has responded

Replies to this message:
 Message 22 by vimesey, posted 10-07-2016 6:32 AM mike the wiz has responded
 Message 23 by Tangle, posted 10-07-2016 6:47 AM mike the wiz has not yet responded

  
Genomicus
Member (Idle past 140 days)
Posts: 852
Joined: 02-15-2012


Message 20 of 146 (792334)
10-07-2016 6:18 AM
Reply to: Message 17 by mike the wiz
10-07-2016 6:05 AM


My English skills are not sufficient enough to decipher what you're saying here, so I'll opt to disengage in this particular line of discussion with you.
This message is a reply to:
 Message 17 by mike the wiz, posted 10-07-2016 6:05 AM mike the wiz has not yet responded

  
mike the wiz
Member
Posts: 4659
From: u.k
Joined: 05-24-2003


Message 21 of 146 (792335)
10-07-2016 6:25 AM
Reply to: Message 18 by Genomicus
10-07-2016 6:14 AM


Re: Life Looks Engineered
Genomicus, your comment, "appear" is a question-begging-epithet. I could also say, "why then do Ferraris appear to be designed".

You have yet to understand the technical logic behind my argument. The point is, if we take life out of the equation, nothing exists that looks designed and isn't, that also has the features of design.

A natural land bridge looks designed but when we investigate we will see the material is loose and crumbly and the path is not straight or meant for walking on, etc...there is no contingency planning or any of the true elements of design.

So the induction so far is that 100% of things that looks designed but aren't, can be shown to not be designed because they won't have the true features of design.

So then a human body or a ferrari car, don't appear to be designed. If you say a human appears to be designed you also have to say a ferrari appears to be designed, because they both equally have all of the features of design. To use the question-begging-epithet, "appearance" while discussing anatomy and genetics, is therefore the special-pleading fallacy, because you would not use the term, "appearance" while describing a car's design, you would just use the term, "design".

The features of specified complexity, contingency planning, are really in the anatomy, like they are really in a car, so your argument is SPECIAL PLEADING - you are asking me to treat actual intelligent design as appearance, in lifeforms, but as design in a car, even though in both the car and the eyeball, the specified complexity is present, meaning an eyeball is constructed to give vision, OVERTLY upon investigation, and a car is constructed to drive, OVERTLY, by investigation. If an eyeball and a car is not constructed to drive then we could DESTROY the arrangement of parts in both and they would still function.

I appreciate your honesty, but be careful to be more objective, because the features of design in life don't only "appear". Remember, there is no argument for the "appearance" argument other than the words, "it's appearance" meaning the appearance-argument is not an argument, it is a WORD.

Think about it - can you formulate a strong argument for, "appearance"? No - for it is just a WORD you use.


This message is a reply to:
 Message 18 by Genomicus, posted 10-07-2016 6:14 AM Genomicus has not yet responded

Replies to this message:
 Message 24 by jar, posted 10-07-2016 9:29 AM mike the wiz has not yet responded
 Message 29 by Taq, posted 10-07-2016 10:56 AM mike the wiz has not yet responded

  
vimesey
Member
Posts: 967
From: Birmingham, England
Joined: 09-21-2011
Member Rating: 6.6


(1)
Message 22 of 146 (792336)
10-07-2016 6:32 AM
Reply to: Message 19 by mike the wiz
10-07-2016 6:15 AM


and the premises have to be true

Therein lies the weakness in your own syllogism. You assume the premises are true. We do not share your assumption.


Could there be any greater conceit, than for someone to believe that the universe has to be simple enough for them to be able to understand it ?

This message is a reply to:
 Message 19 by mike the wiz, posted 10-07-2016 6:15 AM mike the wiz has responded

Replies to this message:
 Message 88 by mike the wiz, posted 10-30-2016 7:39 AM vimesey has responded

    
Tangle
Member
Posts: 6954
From: UK
Joined: 10-07-2011
Member Rating: 4.9


(1)
Message 23 of 146 (792337)
10-07-2016 6:47 AM
Reply to: Message 19 by mike the wiz
10-07-2016 6:15 AM


MtW writes:

If you want to give an example of a SOUND syllogism...

To mirror your daft approach to knowledge, this is a fallacy of tautology and begging the question ... 'if it's true, then it's true'.

We can't know a table isn't an elephant without observation. Once we have observation - i.e. science - we know. Until we know, the syllogism is worthless because we can't tell whether it's valid or otherwise.

The 'conclusion' derived from the syllogism is merely a hypothesis. Your word tricks are far inferior to observation and indeed, depend on them.

Edited by Tangle, : No reason given.


Je suis Charlie. Je suis Ahmed. Je suis Juif. Je suis Parisien.

Life, don't talk to me about life - Marvin the Paranoid Android

"Science adjusts it's views based on what's observed.
Faith is the denial of observation so that Belief can be preserved."
- Tim Minchin, in his beat poem, Storm.


This message is a reply to:
 Message 19 by mike the wiz, posted 10-07-2016 6:15 AM mike the wiz has not yet responded

  
jar
Member
Posts: 31081
From: Texas!!
Joined: 04-20-2004
Member Rating: 3.4


Message 24 of 146 (792338)
10-07-2016 9:29 AM
Reply to: Message 21 by mike the wiz
10-07-2016 6:25 AM


Re: Life Looks Engineered
Logic is irrelevant when dealing with reality as you have been told in the past. Things exist that are illogical. That is a fact.

You begin with an unsupported assertion that something that appears to be designed was designed.

Until you can support that it has no meaning.

But wait, there's more.

When things can be explained without the necessity of inserting some unevidence designer the existence of any such unevidenced designer is just pointless.

Why should anyone insert the unevidenced designer when there is no reason or necessity to insert the unevidenced designer UNLESS the actual point of the exercise is an attempt to insert the unevidenced designer without the necessity of actually doing any research, providing any evidence or get around the restrictions required of reality based science?


My Sister's Website: Rose Hill Studios     My Website: My Website

This message is a reply to:
 Message 21 by mike the wiz, posted 10-07-2016 6:25 AM mike the wiz has not yet responded

  
New Cat's Eye
Inactive Member


Message 25 of 146 (792339)
10-07-2016 9:46 AM
Reply to: Message 1 by mike the wiz
10-06-2016 6:04 PM


The syllogism I have used for ID, was never meant to be used as a creationist argument, but only as a way to ASCERTAIN if an object or thing, is designed;

If something has the elements of design it is designed. (X is X, Law of identity)
Life has the elements of design
Therefore life is designed.

Now I am not arguing this argument here and now, I know you don't accept it, but can you accept the conclusion only says whether something is designed? It is not meant to say who or what the designer is, and has nothing to do with who or what the designer is.

Then that is not an argument for ID, because you haven't reached a conclusion that the designer is intelligent.


This message is a reply to:
 Message 1 by mike the wiz, posted 10-06-2016 6:04 PM mike the wiz has not yet responded

  
Percy
Member
Posts: 18613
From: New Hampshire
Joined: 12-23-2000
Member Rating: 2.9


Message 26 of 146 (792340)
10-07-2016 9:59 AM
Reply to: Message 1 by mike the wiz
10-06-2016 6:04 PM


mike the wiz writes:

While I acknowledge that you might not accept the present form of ID as anything other than a watered down form of creationism, can you accept that if a syllogism contains no premises that mention creation or God, then strictly speaking, technically, the syllogism itself is not creationist?

Technically? Okay, sure, I guess, in a technical sense, but we all know where you're going. Very few non-creationists make arguments like yours. You can't ask us to deny simple and obvious conclusions.

You say you have your own ID views distinct from mainstream ID, but your list of criteria for concluding intelligent design, like specified complexity, are just mainstream ID. Your attempts at logical argument add nothing to ID and for the most part aren't logical. If ID were truly science then it would be possible to draw connections between its tenets and the real world.

If something has the elements of design it is designed. (X is X, Law of identity)
Life has the elements of design
Therefore life is designed.

The problem is in your initial premise. I see that replies to you have divided into several camps on this point. One concedes that life is designed but argues that that says nothing about who or what did the designing, while another argues that evolution did the designing. Another camp calls it apparent design but not actual design. And yet another camp says it doesn't resemble any known form of design by intelligent beings (namely us) that we would recognize, the best we can do seeming to be a pale and very poor mimic of some of life's simpler processes, something we'll undoubtedly get better at, but not something we would have ever designed ourselves.

I'm in the camp that rejects your initial premise. By what criteria do you conclude that life or the Earth or the solar system or the universe has the qualities of design. Certainly not by any used by these realms of science, namely biology, geology, astronomy and cosmology.

Arguments like, "DNA looks designed," or "The solar system looks designed," or "The universe looks designed," have no evidentiary foundation in the way that Coyote's arguments for flint chips do. We *know* that humans manipulate flint, we know what it looks like, and we recognize it when we see it. But when we look at DNA there's nothing similar to compare to that we know was designed by intelligent beings. And if complexity is evidence of intelligent origin, this hasn't been demonstrated, either.

The common ID response, usually some form of "You're denying the obvious because you're beholden to your paradigm," draws the obvious response, "If skepticism is undeserved then provide an unbroken chain of evidence." This is often where the detailed arguments begin, like "Specified complexity can only originate with intelligence, and life has specified complexity," which draws the inevitable response, "Specified complexity is a made up concept, and life wasn't created in a single step but followed processes of very gradually increasing complexity following the known natural laws of the universe."

--Percy


This message is a reply to:
 Message 1 by mike the wiz, posted 10-06-2016 6:04 PM mike the wiz has not yet responded

Replies to this message:
 Message 30 by Genomicus, posted 10-07-2016 10:56 AM Percy has responded

    
Taq
Member
Posts: 7971
Joined: 03-06-2009
Member Rating: 4.5


(1)
Message 27 of 146 (792341)
10-07-2016 10:48 AM
Reply to: Message 18 by Genomicus
10-07-2016 6:14 AM


Re: Life Looks Engineered
Genomicus writes:

When we go into the realm of molecular biology, the appearance of engineering only strengthens.

What we also need to remember is how unreliable appearances are. At one time, the Sun appeared to move about the Earth instead of the Earth moving about the Sun. I can look up into the sky and find clouds that have the appearance of ducks or dragons. That doesn't mean there are dragons flying through the air.

The whole point of science, and the reason it has been so successful, is that it ignores appearances. Appearances are nothing more than human biases.

What we have instead are phylogenies that span billions of years. That is evidence independent of any appearances. Those are facts, and those facts falsify intelligent design as described by ID proponents.

Edited by Taq, : No reason given.


This message is a reply to:
 Message 18 by Genomicus, posted 10-07-2016 6:14 AM Genomicus has responded

Replies to this message:
 Message 32 by Genomicus, posted 10-07-2016 11:08 AM Taq has responded

  
Dr Adequate
Member
Posts: 16097
Joined: 07-20-2006


Message 28 of 146 (792342)
10-07-2016 10:53 AM
Reply to: Message 1 by mike the wiz
10-06-2016 6:04 PM


If something has the elements of design it is designed. (X is X, Law of identity)
Life has the elements of design
Therefore life is designed.

"If something is designed then it is designed" would be the law of identity.

To examine your proposition, which is different, we would have to know what you think "the elements of design" are.

We would then need to verify your premises by checking (a) whether all things which have these elements are indeed designed (b) whether life has those elements.

Now, suppose we cannot agree on whether things with what you denote as "the elements of design" really are always designed. Suppose I were to suggest that some of them, namely living organisms, were products of evolution. Then in order to establish the first premise, you would have to come up with some argument that living things are designed rather than evolved. Which is what you were trying to do in the first place: in order to make you argument for the design and against the evolution of organisms watertight, you would first have to construct a watertight argument for the design and against the evolution of organisms.


This message is a reply to:
 Message 1 by mike the wiz, posted 10-06-2016 6:04 PM mike the wiz has not yet responded

  
Taq
Member
Posts: 7971
Joined: 03-06-2009
Member Rating: 4.5


(1)
Message 29 of 146 (792343)
10-07-2016 10:56 AM
Reply to: Message 21 by mike the wiz
10-07-2016 6:25 AM


Re: Life Looks Engineered
mike the wiz writes:

Genomicus, your comment, "appear" is a question-begging-epithet. I could also say, "why then do Ferraris appear to be designed".

When do Ferrari's mate and produce offspring that are imperfect copies of their parents?

When do we see populations of breeding Ferrari's evolve right before our eyes?

When do we see millions of species of Ferrari's forming statistically supported phylogenies?

The features of specified complexity, contingency planning, are really in the anatomy, like they are really in a car, so your argument is SPECIAL PLEADING - you are asking me to treat actual intelligent design as appearance, in lifeforms, but as design in a car, even though in both the car and the eyeball, the specified complexity is present, meaning an eyeball is constructed to give vision, OVERTLY upon investigation, and a car is constructed to drive, OVERTLY, by investigation. If an eyeball and a car is not constructed to drive then we could DESTROY the arrangement of parts in both and they would still function.

No ID proponent has ever been able to detect complex specified information in biology using a scientific and falsifiable model of CSI. If you think I am wrong, then please measure the complex specified information in this DNA sequence:

TAACTCGATCAGTCACTCGCTATTCGAACTGGGCGAAAGATCCCAGCGCT
CATGCACTTGATCCCGAGGCCTGACCCGATATATGAGCTCAGACTAGAGC

The reason that Paley's argument is not taken seriously is that it has already been disproven by science. The reason that ID is labeled as creationism is simple. The only reason ID is being pushed is because of the theological beliefs of those pushing it. ID has no explanatory power. ID has already been falsified by science. Even the proponents of ID admit that the reason they are pushing ID is to evangelize.

Edited by Taq, : No reason given.

Edited by Admin, : Break long line in middle.


This message is a reply to:
 Message 21 by mike the wiz, posted 10-07-2016 6:25 AM mike the wiz has not yet responded

  
Genomicus
Member (Idle past 140 days)
Posts: 852
Joined: 02-15-2012


Message 30 of 146 (792344)
10-07-2016 10:56 AM
Reply to: Message 26 by Percy
10-07-2016 9:59 AM


Arguments like, "DNA looks designed," or "The solar system looks designed," or "The universe looks designed," have no evidentiary foundation in the way that Coyote's arguments for flint chips do. We *know* that humans manipulate flint, we know what it looks like, and we recognize it when we see it. But when we look at DNA there's nothing similar to compare to that we know was designed by intelligent beings.

Not sure if you're referring strictly to DNA as a molecule here, in and of itself, or the whole genetic code. Because when it comes to the genetic code, there's plenty that's similar to it -- phenomena which we know are the products of agency. The canonical genetic code is a code in a very real sense -- this isn't metaphorical language employed by biologists. And codes and data transmission -- complete with error-correcting mechanisms, parity structure, etc. -- are known to be the products of intelligence.

Keep in mind, too, that the presence of a genetic code was not anticipated by the non-teleological perspective of biotic reality. Rather, that perspective had to accommodate the existence of a canonical genetic code:

"Imagine that in 1957 a clairvoyant biologist offered as a hypothesis the exact genetic code and mechanism of protein synthesis understood today. How would the proposal have been received? My guess is that Nature would have rejected the paper. 'This notion of the ribosome ratcheting along the messenger RNA three bases at a time—it sounds like a computer reading a data tape. Biological systems don’t work that way. In biochemistry we have templates,where all the reactants come together simultaneously, not assembly lines where machines are built step by step.'"

From: Hayes, B. The Invention of the Genetic Code. American Scientist.

And since there's a lack of historical evidence for the molecular evolution of the genetic code, it's perfectly reasonable to argue that there are tangible clues that parts of the biotic world are the products of engineering.


This message is a reply to:
 Message 26 by Percy, posted 10-07-2016 9:59 AM Percy has responded

Replies to this message:
 Message 31 by Taq, posted 10-07-2016 11:00 AM Genomicus has responded
 Message 42 by Dr Adequate, posted 10-07-2016 12:48 PM Genomicus has responded
 Message 51 by Percy, posted 10-07-2016 1:22 PM Genomicus has responded

  
Prev1
2
3456
...
10Next
Newer Topic | Older Topic
Jump to:


Copyright 2001-2018 by EvC Forum, All Rights Reserved

™ Version 4.0 Beta
Innovative software from Qwixotic © 2019