|
Register | Sign In |
|
QuickSearch
Summations Only | Thread ▼ Details |
|
Thread Info
|
|
|
Author | Topic: Nothing in biology makes sense except in the light of evolution. | |||||||||||||||||||||||||||||||||||||||||||
Tangle Member Posts: 9504 From: UK Joined: Member Rating: 4.7 |
Yeh, and the earth is 6,000 years old, snakes talk, Trump is a credit to the USA, everyone should be armed and Noah had a boat.
ffs.Je suis Charlie. Je suis Ahmed. Je suis Juif. Je suis Parisien. I am Mancunian. I am Brum. I am London. "Life, don't talk to me about life" - Marvin the Paranoid Android "Science adjusts it's views based on what's observed.Faith is the denial of observation so that Belief can be preserved." - Tim Minchin, in his beat poem, Storm.
|
|||||||||||||||||||||||||||||||||||||||||||
Faith  Suspended Member (Idle past 1465 days) Posts: 35298 From: Nevada, USA Joined: |
All true except only very special snakes talk.
|
|||||||||||||||||||||||||||||||||||||||||||
RAZD Member (Idle past 1426 days) Posts: 20714 From: the other end of the sidewalk Joined:
|
The only "new species" that have ever arisen are not really new species, they are nothing but the usual intraspecies variation, misnamed because a particular variation has reached the point where it is genetically incapable of breeding with the mother population. ... And the other daughter species ... the very definition of biological speciation. Isn't it amazing that you keep validating evolution? It doesn't matter what you say Faith, if you are going to attack evolution you need to use the definitions in the science or you are just talking babble, delusional babble.
... And honest observation should also lead to the recognition that at that point such a variation or race is too genetically depleted to evolve any further anyway. ... Any truly honest observation should also lead to the recognition that mutations supply new variations, possibly even adding more than were available before. When you deny half of the process your "explanation" is half-vast.
That's all there is, there is no such thing as species-to-species change. Except that it HAS been observed according to the scientific terminology, so only delusional creationists deny these facts. We seen them here ranting and dancing about, but the facts remain facts. And the way you, Faith, "observe" things, has time and again been shown to have no effect on reality. You don't get to make up reality. Enjoyby our ability to understand Rebel☮American☆Zen☯Deist ... to learn ... to think ... to live ... to laugh ... to share. Join the effort to solve medical problems, AIDS/HIV, Cancer and more with Team EvC! (click)
|
|||||||||||||||||||||||||||||||||||||||||||
Taq Member Posts: 10038 Joined: Member Rating: 5.3
|
Faith writes: And honest observation should also lead to the recognition that at that point such a variation or race is too genetically depleted to evolve any further anyway. Honest observation should recognize that mutations continually increase genetic diversity in a population.
|
|||||||||||||||||||||||||||||||||||||||||||
Taq Member Posts: 10038 Joined: Member Rating: 5.3 |
Dredge writes: Charles Darwin wrote the first science-fiction novel. If he were alive today he would be astonished that so many people have taken the contents of Origin seriously! Once again, absolutely nothing of substance from creationists in the face of mountains of evidence for evolution.
|
|||||||||||||||||||||||||||||||||||||||||||
Faith  Suspended Member (Idle past 1465 days) Posts: 35298 From: Nevada, USA Joined: |
Sure you can define anything to deny reality if you want. That's how evolution is supported, very similar to the political stuff going on these days. Just make it up, sling the bull, if you lie enough it will become true.
Any truly honest observation should also lead to the recognition that mutations supply new variations, possibly even adding more than were available before. And it doesn't matter what the source of variation is, the processes of evolution have to eliminate most of it to bring out a new phenotype. Add all the mutations you want, if evolution is happening you're still going to get genetic depletion in the end because that's how new phenotypes are formed.
|
|||||||||||||||||||||||||||||||||||||||||||
Taq Member Posts: 10038 Joined: Member Rating: 5.3
|
Faith writes: No, that's just normal variation within a Kind, NOT evolutionary theory because the ToE is all about change from species to species, not just within a species. It is always claimed that microevolution IS evolution, what's to stop the changes from turning a reptile into a mammal? I've offered my own theory many times, but it has to be built into the limits of the genome itself for a particular species. If nothing else there is simply no evidence for evolution beyond the common variation of a Species or Kind. It's all theory, all assumption based on the theory. Let's go back to our simple gene and see how mutation, selection, and speciation work. We will start with Species OG (for original gangster).
Species OG allele A TTTTTTTTTTTTTTTTTTTT Speciation begins by the creation of two isolated populations of the OG population so that we have Species A and Species B
Species A allele A Species B allele A TTTTTTTTTTTTTTTTTTTT TTTTTTTTTTTTTTTTTTTT Mutation and selection occurs in each population, but since different mutations and selection pressures occur in each species they end up with different alleles:
Species A allele B Species B allele C TTTTTTTTTTTTTTTTATTT TTTTTTGTTTTTTTTTTTTT Those separate species have now diverged, all through microevolution. This same process occurs again.
Species A allele D Species B allele E TTCTTTTTTTTTTTTTATTT TTTTTTGTTTTTTTGTTTTT And it occurs again:
Species A allele F Species B allele G TTCTTTTTGTTTTTTTATTT TATTTTGTTTTTTTGTTTTT And it occurs again:
Species A allele H Species B allele I TTCTTATTGTTTTTTTATTT TATTTTGTTTTCTTGTTCTT Let's freeze time and compare these new species with the OG species
Species A allele H Species B allele I TTCTTATTGTTTTTTTATTT TATTTTGTTTTCTTGTTCTT Species OG allele A Species OG allele A TTTTTTTTTTTTTTTTTTTT TTTTTTTTTTTTTTTTTTTT That is macroevolution. We have reached the genetic divergence seen between what you would call separate kinds, and it all occurs through microevolution. Macroevolution is the accumulation of microevolutionary events, and when they occur in populations that are not interbreeding it produces divergence over time.
|
|||||||||||||||||||||||||||||||||||||||||||
Faith  Suspended Member (Idle past 1465 days) Posts: 35298 From: Nevada, USA Joined: |
That is ridiculous. A few mutations in a population is not a new species. A new species -- really race or variation -- requires the increase of some alleles over others. With a population split you are going to get a new set of gene frequencies that usually differs from the original population, quite a bit in some cases. A number of generations of inbreeding in each population will bring out the high frequency phenotypes and in some cases lose the low frequency phenotypes altogether until eventually you have two new population with two new separate phenotypic presentations. Different races or variations.
To get these different "species" requires LOSING the alleles for other phenotypes. The overall effect over time is loss of genetic diversity in each population. You get a new "species" or breed or race or variation, like a new population of green warblers or California salamanders, because you've lost the genetic material for the other kinds of green warblers or salamanders. Evolution costs, there is no way around it. Add all mutations you want, if evolution is happening you have to lose most of them. Edited by Faith, : No reason given.
|
|||||||||||||||||||||||||||||||||||||||||||
Taq Member Posts: 10038 Joined: Member Rating: 5.3
|
Faith writes: Sure you can define anything to deny reality if you want. Surely you realize that this is exactly what you are doing.
And it doesn't matter what the source of variation is, the processes of evolution have to eliminate most of it to bring out a new phenotype. As shown above, that results in diverse species with different genomes, otherwise known as macroevolution.
|
|||||||||||||||||||||||||||||||||||||||||||
Taq Member Posts: 10038 Joined: Member Rating: 5.3
|
Faith writes: That is ridiculous. A few mutations in a population is not a new species. "Sure you can define anything to deny reality if you want."--Faith I told you. You are doing the very exact thing that you are accusing others of. Now you are trying to redefine species so that you can deny their existence. The alleles in my example have more differences than those found between chimp and human genes, and I would assume you would classify humans and chimps as separate species.
A new species -- really race or variation -- requires the proliferation of some alleles over others, a set of gene frequencies that usually differs from the original population, quite a bit in some cases. Over a number of generations inbreeding in each population will bring out the high frequency phenotypes and in some cases lose the low frequency phenotypes altogether until eventually you have two new population with two new separate phenotypic presentations. That is exactly what my model does, and it results in macroevolution.
|
|||||||||||||||||||||||||||||||||||||||||||
ringo Member (Idle past 433 days) Posts: 20940 From: frozen wasteland Joined:
|
Dredge writes:
The first science fiction novel was the Bible.
Charles Darwin wrote the first science-fiction novel. Dredge writes:
He'd be amazed at how much sense biology finally makes in the light of evolution.
If he were alive today he would be astonished that so many people have taken the contents of Origin seriously!
|
|||||||||||||||||||||||||||||||||||||||||||
RAZD Member (Idle past 1426 days) Posts: 20714 From: the other end of the sidewalk Joined: |
Sure you can define anything to deny reality if you want. That's how Fixed it for you.
... if you lie enough it will become true. So you keep hoping.
And it doesn't matter what the source of variation is, the processes of evolution have to eliminate most of it to bring out a new phenotype. Add all the mutations you want, if evolution is happening you're still going to get genetic depletion in the end because that's how new phenotypes are formed. So you keep hoping. Evidence shows otherwise.
quote: So in the case of polyploidy a new species is made by doubling the genetic strands. It can lose a lot of genetic material and still have more genes than the parent diploid population, and the duplicated genes can also mutate to evolve new alleles while maintaining the old ones. The real world just does not conform to your fantasy view. Enjoyby our ability to understand Rebel☮American☆Zen☯Deist ... to learn ... to think ... to live ... to laugh ... to share. Join the effort to solve medical problems, AIDS/HIV, Cancer and more with Team EvC! (click)
|
|||||||||||||||||||||||||||||||||||||||||||
Tangle Member Posts: 9504 From: UK Joined: Member Rating: 4.7 |
Dredge writes: If he were alive today he would be astonished that so many people have taken the contents of Origin seriously! I think you need to read up on your history. Darwin knew exactly how seriously his work would be taken before he published Origin, but if he didn't, he certainly would have been immediately afterwards. He started an eruption in both biology and religion that continues to this day - in a few minority backward-looking religions at least. Science, of course, universally accepted evolution over 100 years ago. Most biologists would be astonished that creationist ignorance is still on display at places like this. What I do think he would be surprised about though is how accurate his ideas turned out to be; particularly with the corroboration provided first by genetics, then by molecular genetics. And, of course, the accumulation of evidence in both the fossil record and our understanding of geology and radio dating. It's an enormous acheivement, but of course if it hadn't been him it would have been someone else. This is something creationist don't register; the ToE is a discovery not an invention. The evidence is there in the world for anyone to find, it doesn't go away just because some prefer a fantasy world.Je suis Charlie. Je suis Ahmed. Je suis Juif. Je suis Parisien. I am Mancunian. I am Brum. I am London. "Life, don't talk to me about life" - Marvin the Paranoid Android "Science adjusts it's views based on what's observed.Faith is the denial of observation so that Belief can be preserved." - Tim Minchin, in his beat poem, Storm.
|
|||||||||||||||||||||||||||||||||||||||||||
Taq Member Posts: 10038 Joined: Member Rating: 5.3
|
Tangle writes: It's an enormous acheivement, but of course if it hadn't been him it would have been someone else. This is something creationist don't register; the ToE is a discovery not an invention. The evidence is there in the world for anyone to find, it doesn't go away just because some prefer a fantasy world. In fact, Darwin rushed his work to publication because Alfred Russell Wallace was about to publish nearly the same theory. They co-published and co-presented their theories, but Darwin's work was more complete and better presented so he got the laurels. If it weren't for Darwin publishing we would be calling it Wallacian Evolution, which really doesn't roll of the tongue. Alfred Russel Wallace - Wikipedia If Darwin and Wallace had not published their theories, then it was nearly inevitable that someone else would have discovered and published the very same theory in short order. As the evidence mounted the theory of evolution was an inevitable conclusion.
|
|||||||||||||||||||||||||||||||||||||||||||
dwise1 Member Posts: 5948 Joined: Member Rating: 5.5
|
The first science fiction novel was the Bible. Actually, that title would go to the Epic of Gilgamesh, one of the sources of that derivative work, the Bible.
|
|
|
Do Nothing Button
Copyright 2001-2023 by EvC Forum, All Rights Reserved
Version 4.2
Innovative software from Qwixotic © 2024