Summations Only

Yeh, and the earth is 6,000 years old, snakes talk, Trump is a credit to the USA, everyone should be armed and Noah had a boat.ffs.

All true except only very special snakes talk.

And the other daughter species ... the very definition of biological speciation. Isn't it amazing that you keep validating evolution?It doesn't matter what you say Faith, if you are going to attack evolution you need to use the definitions in the science or you are just talking babble, delusional babble. Any truly honest observation should also lead to the recognition that mutations supply new variations, possibly even adding more than were available before.When you deny half of the process your "explanation" is half-vast. Except that it HAS been observed according to the scientific terminology, so only delusional creationists deny these facts.We seen them here ranting and dancing about, but the facts remain facts. And the way you, Faith, "observe" things, has time and again been shown to have no effect on reality.You don't get to make up reality.Enjoy

Honest observation should recognize that mutations continually increase genetic diversity in a population.

Once again, absolutely nothing of substance from creationists in the face of mountains of evidence for evolution.

Sure you can define anything to deny reality if you want. That's how evolution is supported, very similar to the political stuff going on these days. Just make it up, sling the bull, if you lie enough it will become true. And it doesn't matter what the source of variation is, the processes of evolution have to eliminate most of it to bring out a new phenotype. Add all the mutations you want, if evolution is happening you're still going to get genetic depletion in the end because that's how new phenotypes are formed.

Let's go back to our simple gene and see how mutation, selection, and speciation work. We will start with Species OG (for original gangster).

Species OG allele A
TTTTTTTTTTTTTTTTTTTT

Speciation begins by the creation of two isolated populations of the OG population so that we have Species A and Species B

Species A  allele A               Species B allele A
TTTTTTTTTTTTTTTTTTTT              TTTTTTTTTTTTTTTTTTTT

Mutation and selection occurs in each population, but since different mutations and selection pressures occur in each species they end up with different alleles:

Species A  allele B               Species B allele C
TTTTTTTTTTTTTTTTATTT              TTTTTTGTTTTTTTTTTTTT

Those separate species have now diverged, all through microevolution. This same process occurs again.

Species A  allele D               Species B allele E
TTCTTTTTTTTTTTTTATTT              TTTTTTGTTTTTTTGTTTTT

And it occurs again:

Species A  allele F               Species B allele G
TTCTTTTTGTTTTTTTATTT              TATTTTGTTTTTTTGTTTTT

And it occurs again:

Species A  allele H               Species B allele I
TTCTTATTGTTTTTTTATTT              TATTTTGTTTTCTTGTTCTT

Let's freeze time and compare these new species with the OG species

Species A  allele H               Species B allele I
TTCTTATTGTTTTTTTATTT              TATTTTGTTTTCTTGTTCTT
Species OG allele A               Species OG allele A
TTTTTTTTTTTTTTTTTTTT              TTTTTTTTTTTTTTTTTTTT

That is macroevolution. We have reached the genetic divergence seen between what you would call separate kinds, and it all occurs through microevolution. Macroevolution is the accumulation of microevolutionary events, and when they occur in populations that are not interbreeding it produces divergence over time.

That is ridiculous. A few mutations in a population is not a new species. A new species -- really race or variation -- requires the increase of some alleles over others. With a population split you are going to get a new set of gene frequencies that usually differs from the original population, quite a bit in some cases. A number of generations of inbreeding in each population will bring out the high frequency phenotypes and in some cases lose the low frequency phenotypes altogether until eventually you have two new population with two new separate phenotypic presentations. Different races or variations.To get these different "species" requires LOSING the alleles for other phenotypes. The overall effect over time is loss of genetic diversity in each population. You get a new "species" or breed or race or variation, like a new population of green warblers or California salamanders, because you've lost the genetic material for the other kinds of green warblers or salamanders.Evolution costs, there is no way around it. Add all mutations you want, if evolution is happening you have to lose most of them.Edited by Faith, : No reason given.

Surely you realize that this is exactly what you are doing. As shown above, that results in diverse species with different genomes, otherwise known as macroevolution.

"Sure you can define anything to deny reality if you want."--FaithI told you. You are doing the very exact thing that you are accusing others of. Now you are trying to redefine species so that you can deny their existence. The alleles in my example have more differences than those found between chimp and human genes, and I would assume you would classify humans and chimps as separate species. That is exactly what my model does, and it results in macroevolution.

The first science fiction novel was the Bible. He'd be amazed at how much sense biology finally makes in the light of evolution.

Fixed it for you. So you keep hoping. So you keep hoping.Evidence shows otherwise.

quote:

---

Speciation via polyploidization
Main article: Polyploid

​

Polyploidy is a mechanism that has caused many rapid speciation events in sympatry because offspring of, for example, tetraploid x diploid matings often result in triploid sterile progeny.[52] However, not all polyploids are reproductively isolated from their parental plants, and gene flow may still occur for example through triploid hybrid x diploid matings that produce tetraploids, or matings between meiotically unreduced gametes from diploids and gametes from tetraploids (see also hybrid speciation).

​

It has been suggested that many of the existing plant and most animal species have undergone an event of polyploidization in their evolutionary history.[53][54]

---

So in the case of polyploidy a new species is made by doubling the genetic strands. It can lose a lot of genetic material and still have more genes than the parent diploid population, and the duplicated genes can also mutate to evolve new alleles while maintaining the old ones.The real world just does not conform to your fantasy view.Enjoy

I think you need to read up on your history. Darwin knew exactly how seriously his work would be taken before he published Origin, but if he didn't, he certainly would have been immediately afterwards. He started an eruption in both biology and religion that continues to this day - in a few minority backward-looking religions at least. Science, of course, universally accepted evolution over 100 years ago. Most biologists would be astonished that creationist ignorance is still on display at places like this.What I do think he would be surprised about though is how accurate his ideas turned out to be; particularly with the corroboration provided first by genetics, then by molecular genetics. And, of course, the accumulation of evidence in both the fossil record and our understanding of geology and radio dating.It's an enormous acheivement, but of course if it hadn't been him it would have been someone else. This is something creationist don't register; the ToE is a discovery not an invention. The evidence is there in the world for anyone to find, it doesn't go away just because some prefer a fantasy world.

In fact, Darwin rushed his work to publication because Alfred Russell Wallace was about to publish nearly the same theory. They co-published and co-presented their theories, but Darwin's work was more complete and better presented so he got the laurels. If it weren't for Darwin publishing we would be calling it Wallacian Evolution, which really doesn't roll of the tongue.Alfred Russel Wallace - WikipediaIf Darwin and Wallace had not published their theories, then it was nearly inevitable that someone else would have discovered and published the very same theory in short order. As the evidence mounted the theory of evolution was an inevitable conclusion.

Actually, that title would go to the Epic of Gilgamesh, one of the sources of that derivative work, the Bible.