|
Register | Sign In |
|
QuickSearch
EvC Forum active members: 65 (9164 total) |
| |
ChatGPT | |
Total: 916,426 Year: 3,683/9,624 Month: 554/974 Week: 167/276 Day: 7/34 Hour: 1/2 |
Thread ▼ Details |
Member (Idle past 1366 days) Posts: 104 From: Ottawa, ON, Canada Joined: |
|
Thread Info
|
|
|
Author | Topic: NvC-1: What is the premise of Naturalism in Biology? | |||||||||||||||||||||||||||||||||||
AZPaul3 Member Posts: 8529 From: Phoenix Joined: Member Rating: 5.1 |
... this is not a chemical or physical process, but an information process. There is no need to discover the detail of how the mind operates, people can make the judgement ... In other words, the reality of the full process does not matter when that level of detail counters my concerted attempt to fell natural processes in favor of the anti-science woo that underpins my faith in my blood thirsty sky daddy.Factio Republicana delenda est.
|
|||||||||||||||||||||||||||||||||||
Richard L. Wang Member (Idle past 1366 days) Posts: 104 From: Ottawa, ON, Canada Joined: |
Half a month after I submitted the message RLW(Message 263) on May 27 that Bioinformatic processes don’t obey the natural laws, we’ve posted over 80 messages. I have put all my cards on the table, and you guys still insist that only natural laws play a role in the world. So, I suggest we change a topic, for example, mutations, which PaulK raised ten days ago in PaulK(Message 307).
|
|||||||||||||||||||||||||||||||||||
PaulK Member Posts: 17825 Joined: Member Rating: 2.2 |
Eighty messages in which you have produced no real evidence of bioinformatic processes violating natural law. So what do you expect? That we should just accept your opinion? That certainly isn’t how it works in science.
But yes, let’s discuss how mutations change and add information, since that would be an actually relevant discussion.
|
|||||||||||||||||||||||||||||||||||
Tangle Member Posts: 9504 From: UK Joined: Member Rating: 4.8 |
RLW writes: Half a month after I submitted the message RLW(Message 263) on May 27 that Bioinformatic processes don’t obey the natural laws, we’ve posted over 80 messages. I have put all my cards on the table, and you guys still insist that only natural laws play a role in the world. I've not seen anything at all from you that doesn't obey natural laws and you've refused to own up to your sub agenda that whatever you declare as 'not following natural laws' is therefore following supernatural laws. So how about you actually putting your cards on the table And admitting it. Are you shy? The cock has crowed.Je suis Charlie. Je suis Ahmed. Je suis Juif. Je suis Parisien. I am Mancunian. I am Brum. I am London.I am Finland. Soy Barcelona "Life, don't talk to me about life" - Marvin the Paranoid Android "Science adjusts it's views based on what's observed.Faith is the denial of observation so that Belief can be preserved." - Tim Minchin, in his beat poem, Storm.
|
|||||||||||||||||||||||||||||||||||
AZPaul3 Member Posts: 8529 From: Phoenix Joined: Member Rating: 5.1 |
we’ve posted over 80 messages. I have put all my cards on the table, and you guys still insist that only natural laws play a role in the world. That should tell you two things. First, your presentations toward your non-natural woo-woo processes have not been compelling enough to be given serious consideration. Second, that your contention that anything other than natural processes operating in this universe may be wrong.
I suggest we change a topic, for example, mutations... If you must. Just keep in mind that any processes you may suggest that do not adhere to strictly natural processes and functions will require the most compelling evidence be presented. Something no one else in this decades long debate has ever been able to do. Good luck. Edited by AZPaul3, : No reason given.Factio Republicana delenda est.
|
|||||||||||||||||||||||||||||||||||
PaulK Member Posts: 17825 Joined: Member Rating: 2.2 |
In the context of reproductive biology, the information in a DNA molecule is entirely determined by the sequence of bases. Thus, changes to the information - including additions - must be changes to that sequence.
Mutations do change that sequence, adding to it, removing from it, changing bases and even swapping one part of the sequence to another. Creationists have tried to argue that mutations cannot add information, but those arguments generally founder on the lack of a suitable measure of information. Typically no measure is given, but even when one is showing that it is relevant and actually applying it properly are serious difficulties. I believe, however, that there are two arguments which make a case that mutation can add information. The first relies on the simple fact that point mutations - the replacement of one base with another - are reversible - any change made by one such mutation can be done by another. Unless we assume that all sequences of a given length have the same amount of information then point mutations can change the information content - and if any mutation causes a loss the reverse mutation must cause a gain of information. The second relies on multiple mutations. The addition of a new, distinct gene to a genome - differing from the other genes, at least slightly - is surely a gain of information. Certainly it is if the protein that the gene codes for is produced and is useful to the organism. Mutation can and does do this, although it takes multiple steps. First an existing gene is duplicated, then - in some cases - subsequent mutations change one of the copies, making it distinct. With the aid of selection that version can become adapted to a particular use - which may or may not have been served by the original gene. For instance a gene involved in blood clotting could evolve to produce a venom. This is called duplication and diversification While these arguments as I have presented them fall short of proof they still represent a very good reason to think that mutations can add information. Unless they can be overcome it is not at all reasonable to insist that mutations cannot add information.
|
|||||||||||||||||||||||||||||||||||
Kleinman Member (Idle past 357 days) Posts: 2142 From: United States Joined: |
PaulK writes:
Information like beauty is in the eye of the beholder.
While these arguments as I have presented them fall short of proof they still represent a very good reason to think that mutations can add information. Unless they can be overcome it is not at all reasonable to insist that mutations cannot add information.
|
|||||||||||||||||||||||||||||||||||
PaulK Member Posts: 17825 Joined: Member Rating: 2.2 |
quote: An assertion that does more to undermine Richard Wang’s arguments than mine.
|
|||||||||||||||||||||||||||||||||||
Kleinman Member (Idle past 357 days) Posts: 2142 From: United States Joined: |
Kleinman writes:
The problem with your argument is that it is vague. You make the statement, "there are two arguments which make a case that mutation [sic] can add information"? What do you mean by "add information" and how do you measure this? Do all mutations add information?
Information like beauty is in the eye of the beholder.PaulK writes: An assertion that does more to undermine Richard Wang’s arguments than mine.
|
|||||||||||||||||||||||||||||||||||
PaulK Member Posts: 17825 Joined: Member Rating: 2.2 |
quote: It isn’t at all - if you accept the idea that DNA contains information relevant to the construction of the phenotype. And if you recognise that this is in the context of Richard Wang claiming that material processes cannot add information and that this is a prob,em for evolution.
quote: The first argument is constructed to avoid any need to define it further. It is only necessary to accept that a point mutation can change the amount of information in the DNA. A refusal to accept that point will lead to serious problems for any evolutionary argument. The second argument appeals to the intuitive point that two useful genes with differing sequences will contain more information than either one on their own. There is no need for further measurement if that is accepted - and refusing to accept it is both counter-intuitive and likely to cause problems for the opposing argument.
quote: This shows that the problem is in the reader, not the text since the first argument makes it clear that if an increase is possible then a decrease is also possible,
|
|||||||||||||||||||||||||||||||||||
AZPaul3 Member Posts: 8529 From: Phoenix Joined: Member Rating: 5.1 |
Information like beauty is in the eye of the beholder. In other words your definition can be whatever you need it to be to fit your pre-conceived conclusion. Such a scientist you are, Richard. Nail it down hard. In talking about genetic mutations, information is defined as the sequence of nucleobases present in any specific nucleic acid portion. By convention, a human construct, the bases are labeled A, C, T, G in a DNA strand. As a starting initial sequence a short strand of DNA (double helix) may be represented as: ATCCATAGCAAAGCGCTTGAGATCCGGTTATACGGCTTGCGATGGGATATCCAGAGCTTAACCGCGTA As our example, this sequence of bases, in this specific order, is the information contained in this DNA segment. By convention, any change in this sequence of bases, by whatever means, is called a mutation of the starting initial sequence. *ANY* change to the initial sequence of bases in a DNA segment is a mutation. As a result, *ANY* mutation is a change in information. Richard, do you agree with these definitions? If not, where/why would you differ?Factio Republicana delenda est.
|
|||||||||||||||||||||||||||||||||||
Kleinman Member (Idle past 357 days) Posts: 2142 From: United States Joined: |
Kleinman writes:
I'm not Richard. So, let's see what your pre-conceived idea of what genetic information is.
Information like beauty is in the eye of the beholder.AZPaul3 writes: In other words your definition can be whatever you need it to be to fit your pre-conceived conclusion. Such a scientist you are, Richard. AZPaul3 writes:
Do you mean nail it down hard such as you nailed it down hard on the number of replications necessary for a beneficial mutation to occur in the Kishony experiment? You hammered that down to between 1 and infinity. Such a scientist you are.
Nail it down hard.AZPaul3 writes:
What information are you seeing there? And what is the difference in the information from one sequence of nucleobases to another?
In talking about genetic mutations, information is defined as the sequence of nucleobases present in any specific nucleic acid portion.AZPaul3 writes:
Again, I'm not Richard. Your definitions are vague. For example, you say "this sequence of bases, in this specific order, is the information contained in this DNA segment". Are you saying that any sequences of bases has information in it? If so, that's like saying any sequence of letters can make up words, sentences, paragraphs, chapters,... You haven't defined information as it pertains to genetics and how you measure it. So, what information is your eye beholding in these genetic sequences? I think you need a rosetta stone to decipher the information in your genetic hieroglyphics.
By convention, a human construct, the bases are labeled A, C, T, G in a DNA strand. As a starting initial sequence a short strand of DNA (double helix) may be represented as: ATCCATAGCAAAGCGCTTGAGATCCGGTTATACGGCTTGCGATGGGATATCCAGAGCTTAACCGCGTA As our example, this sequence of bases, in this specific order, is the information contained in this DNA segment. By convention, any change in this sequence of bases, by whatever means, is called a mutation of the starting initial sequence. *ANY* change to the initial sequence of bases in a DNA segment is a mutation. As a result, *ANY* mutation is a change in information. Richard, do you agree with these definitions? If not, where/why would you differ?
|
|||||||||||||||||||||||||||||||||||
AZPaul3 Member Posts: 8529 From: Phoenix Joined: Member Rating: 5.1 |
I'm not Richard. My apologies.
You hammered that down to between 1 and infinity. Such a scientist you are. And I was right, despite your self-serving bogus mathematics.
What information are you seeing there? Dense as a stump. The information is the sequence of the nucleobases. If you can't understand what that means then take a semester of beginning genetics.
And what is the difference in the information from one sequence of nucleobases to another? The difference in the sequence *is* the difference in the information. You got a real strong handle on this don't ya.
Are you saying that any sequences of bases has information in it? If you understood how DNA relates to genetics you would know the answer to that question. Right now we're not relating the information to the chemical operations. We're only establishing that the sequence is the information and that changes to the sequence is mutation.
Again, I'm not Richard. Again my apologies. This message isn't for you. I'll wait for Dr. Wang to respond.Factio Republicana delenda est.
|
|||||||||||||||||||||||||||||||||||
Kleinman Member (Idle past 357 days) Posts: 2142 From: United States Joined: |
Kleinman writes:
Even Taq was able to hammer that one better than you when he calculated 3e9 replications for each beneficial mutation. How does that serve you?
You hammered that down to between 1 and infinity. Such a scientist you are.AZPaul3 writes: And I was right, despite your self-serving bogus mathematics.Kleinman writes:
How much information in the sequence? Is that another one with between 1 and infinity? Such a scientist you are. And we marvel at your mathematical skills.
What information are you seeing there?
AZPaul3 writes: Dense as a stump. The information is the sequence of the nucleobases. If you can't understand what that means then take a semester of beginning genetics.Kleinman writes:
So if the sequence is twice as long, it has between 2 and 2*infinity amount of information? Such a scientist you are.
And what is the difference in the information from one sequence of nucleobases to another?AZPaul3 writes: The difference in the sequence *is* the difference in the information. You got a real strong handle on this don't ya.Kleinman writes:
So, how much does a mutation change the information in a sequence? Is that between 1 and infinity as well? Such a scientist you are.
Are you saying that any sequences of bases has information in it?AZPaul3 writes: If you understood how DNA relates to genetics you would know the answer to that question. Right now we're not relating the information to the chemical operations. We're only establishing that the sequence is the information and that changes to the sequence is mutation.Kleinman writes:
Well, thank you for nailing down for us that genetic information is simply a sequence and it has a value of 1 to infinity. Such a scientist you are.
Again, I'm not Richard.AZPaul3 writes: Again my apologies. This message isn't for you. I'll wait for Dr. Wang to respond.
|
|||||||||||||||||||||||||||||||||||
Richard L. Wang Member (Idle past 1366 days) Posts: 104 From: Ottawa, ON, Canada Joined: |
Richard is here.
As PaulK(Message 307) wrote
quote: How do you know it? What is the evidence to support your assertion?
|
|
|
Do Nothing Button
Copyright 2001-2023 by EvC Forum, All Rights Reserved
Version 4.2
Innovative software from Qwixotic © 2024