Who Owns the Standard Definition of Evolution

I suspect the important point for K.Rose to understand here is that not all of those hominid species were alive at the same time. For example, there were no Homo species around when early Australopithecines were around.

quote:

---

(A) Pan troglodytes, chimpanzee, modern
(B) Australopithecus africanus, STS 5, 2.6 My
(C) Australopithecus africanus, STS 71, 2.5 My
(D) Homo habilis, KNM-ER 1813, 1.9 My
(E) Homo habilis, OH24, 1.8 My
(F) Homo rudolfensis, KNM-ER 1470, 1.8 My
(G) Homo erectus, Dmanisi cranium D2700, 1.75 My
(H) Homo ergaster (early H. erectus), KNM-ER 3733, 1.75 My
(I) Homo heidelbergensis, "Rhodesia man," 300,000 - 125,000 y
(J) Homo sapiens neanderthalensis, La Ferrassie 1, 70,000 y
(K) Homo sapiens neanderthalensis, La Chappelle-aux-Saints, 60,000 y
(L) Homo sapiens neanderthalensis, Le Moustier, 45,000 y
(M) Homo sapiens sapiens, Cro-Magnon I, 30,000 y
(N) Homo sapiens sapiens, modern

---

It doesn't make any sense to ask if two individuals who lived millions of years apart could interbreed.Even if there were interbreeding between the different species that coexisted, we still see an evolutionary progression from ape-like to human-like.

I get the impression that K.Rose is a bit less strident on that topic. There seems to be a willingness to take the dates at face value and see if it works as evidence.

More importantly, we need theories that explain what we do know. That's an issue that creationists often get tripped up on. They often confuse assumptions with conclusions. For example, we don't assume common ancestry. We conclude that species share a common ancestor because of the evidence. We don't assume that the differences between species is due to evolutionary mechanisms. We conclude that those differences are due to evolution because of the evidence (e.g. transitions outnumber transversions). More to the point, we don't assume a fossil is transitional. We conclude that a fossil is transitional because it has a mixture of features from two different groups (e.g. a mixture of ape and human features).

PaulK gave a great answer. Here is my spin.We start with processes we can observe. We then ask what we should and shouldn't see in present if those processes were active in the past. That's it. If our hypothesis is supported by observations, then we understand a bit more about what we are seeing in the present and its history.It's really no different than a forensic scientist trying to reconstruct a crime that happened in the past. Given what creationists have said in this thread, it would seem that no creationist would accept any evidence found at a crime scene because the supernatural could have been at play. The past is wholly untestable, or at least it would seem that way from their arguments.

A is a modern chimp, it is only there to represent basal ape features.No fossil can tell us who its ancestors are nor who its descendants are. Even if we dug up a human skeleton we could not determine these things, short of sequencing DNA.What the evidence demonstrates is that hominids looked more and more like modern humans through time, exactly what we would expect to see if humans evolved from a common ancestor shared with other apes. These are exactly the transitional fossils that creationists ask for. That simply isn't true. No living human has the combination of pronounced eyebrow ridges, a huge gap between nose and upper lip, lack of a forehead, lack of a chin (shown in other specimens), and strong forward jutting jaw. They were separated by hundreds of thousands, even millions of years. How could they interbreed?

That is true of every single theory in science, including the theories you accept. The difference is that the evolutionists have mountains of scientific evidence to back their conclusions. Creationists do not have evidence, and as you have shown creationists are immune to evidence. The difference in worldviews is that Creationists don't care what the evidence shows. As the creationist organization Answers in Genesis states:

quote:

---

No apparent, perceived, or claimed evidence in any field of study, including science, history, and chronology, can be valid if it contradicts the clear teaching of Scripture obtained by historical-grammatical interpretation.
--Answers in Genesis
Statement of Faith | Answers in Genesis

---

The impasse is that evolutionists care about facts and evidence. Creationists do not.

The core difference is that evolution is a scientific theory backed by mountains of evidence. Creationism is a religious dogma that lacks evidence and is impervious to evidence. Creationists did not arrive at their position because of evidence, and there is no evidence that can budge them. For a Creationist to change their mind they are going have to change their worldview to one where observable facts matter. Creationism is anti-science because it refuses to address observable facts and rejects theories solely on the basis of the theory's conflict with religious dogma. Thank you for admitting your rejection of evidence because of religious belief. As to validation of measurements, its done all of the time. Yet another attempt to find an excuse to ignore the evidence. That's completely false. Neither evolution nor an ancient Earth challenges Christian faith as described by the Clerge Letter Project (signed by over 15,000 Christian clergy):

quote:

---

We the undersigned, Christian clergy from many different traditions, believe that the timeless truths of the Bible and the discoveries of modern science may comfortably coexist. We believe that the theory of evolution is a foundational scientific truth, one that has stood up to rigorous scrutiny and upon which much of human knowledge and achievement rests. To reject this truth or to treat it as “one theory among others” is to deliberately embrace scientific ignorance and transmit such ignorance to our children. We believe that among God’s good gifts are human minds capable of critical thought and that the failure to fully employ this gift is a rejection of the will of our Creator. To argue that God’s loving plan of salvation for humanity precludes the full employment of the God-given faculty of reason is to attempt to limit God, an act of hubris. We urge school board members to preserve the integrity of the science curriculum by affirming the teaching of the theory of evolution as a core component of human knowledge. We ask that science remain science and that religion remain religion, two very different, but complementary, forms of truth.
The Clergy Letter Project

---

Yes, just like we force Germ Theory, Atom Theory, Theory of Relativity, and all of the other theories they are taught. Give me a break. This is why creationists are deemed to be anti-science. The theory of evolution is one of the most well supported theories in all of science, and the only reason you can come up with to not teach it is because of what some misguided Christians teach about it.While we are at it, is Heliocentrism forced on kids too?

quote:

---

But to want to affirm that the Sun, in very truth, is at the centre of the universe and only rotates on its axis without traveling from east to west, and that the Earth is situated in the third sphere and revolves very swiftly around the Sun, is a very dangerous attitude and one calculated not only to arouse all Scholastic philosophers and theologians but also to injure our hold faith by contradicting the Scriptures….
--Cardinal Bellarmine, 1615

---

If we teach that the Earth rotates on its axis and moves about the Sun do we also have to have Bible studies that show otherwise? You mean the Biblical principles like not having any other God before the God of the Bible? How would that work in a pluralistic society with freedom of religion?

That's because creationists refuse to accept evidence.We have mountains and mountains of evidence demonstrating that species share a common ancestor and that the mechanisms of evolution are responsible for the differences between them. The differences in sequence conservation in exons and introns demonstrates natural selection. The match between the patterns of transitions and transversions seen in new mutations and the differences between the genomes of species demonstrates that the process of mutation we see happening right now is responsible for the differences between species. The nested hierarchy demonstrates both common ancestry and natural selection/mutation acting in concert with vertical inheritance.We have all the evidence, but you won't address any of it. It's just ignored with a handwave. Evolution isn't a worldview. It's a theory supported by mountains and mountains of evidence. That no one can doubt the dogma of creationism no matter the evidence is signifcant.I have already shown how to calculate the doubt (i.e. p values) in previous posts, and it was ignored.

How else would it be? Do you think the Universe was zapped into being this very microsecond? Aren't you the result of past processes? We do understand them. I've been showing you how those processes work. NO!!! We run tests to see if these processes were active in the past. Those are the tests I have been showing you. It's not circular because we don't assume present processes were active in the past. We run SCIENTIFIC TESTS to determine if they were active in the past. You appear to be part of a worldview where only an unquestionable dogma counts as knowledge.If you require 0% doubt then you must reject all of science. Are you going to do that?The reason that we call creationism anti-science is your very attitude. You require 0% doubt which means you must reject all of science. You repeatedly claim that scientific hypotheses are assumptions. THEY AREN'T. You refuse to address the evidence. This is anti-science.

1. Background information
2. Hypothesis
3. Experiment
4. ConclusionThese are the 4 basic steps of the scientific method. Let's see how it applies to the DNA differences between humans and other apes.1. Background information: We observe mutations happening in humans by comparing up to three generations of parents and offspring. When we categorize these mutations we put them into 4 buckets due to different factors, such as DNA being double stranded. Those buckets are: 'T<>C/G<>A', 'G<>C', 'A<>T', and 'A<>C/G<>T'. Just to make this clear, a mutation of a G to an A would fall into the first bucket, as would a A to a G, C to a T, or a T to C. A G to a C or a C to a G would fit into the 2nd bucket.If there were an equal chance of a base mutating into one of the 3 other bases then we can predict what the pattern should be. In fact, I wrote a Python script that ran a simulation of 2,200 mutations across 60 million bases in a genome with 41% GC content which is the case in humans (41% of the sequence is GC while 59% is AT) and across 4 trials. Here are my results:T<>C/G<>A = 0.342 +/- 0.00812225796070065
G<>C = 0.133 +/- 0.008323272163286037
A<>T = 0.19290909090909092 +/- 0.009450829689407263
A<>C/G<>T = 0.3320909090909091 +/- 0.007340592450249576This is what we would expect if there was an equal chance of every mutation. So what do we actually see when we look at new mutations (de novo mutations) in humans?That's not at all what we would expect from equal chances (new measured mutations in green). The first bucket is clear up to almost 0.7 instead of 0.33. Both the 2nd and 3rd buckets are below where they should be (0.13 and 0.19 expected) as is the 4th bucket (0.33 expected).What's going on? Well, we know that there are two mechanisms in action. First, some nucleotides are closer to one another at a molecular level than others:There are bases with one ring and bases with two rings. From a biochemical point of view, it is more likely that an enzyme will mistake the similar bases for one another. We call these transition mutations. Mutations between dissimilar bases are called transversions, and there are two transversions and only one transition possible for each substitution mutation. Even though there is a 1:2 ratio between transition and transversion mutations there are still way more transition mutations than transversion mutations. There is also deamination of methylated cytosines at CpG's. This is a fancy way of saying that a C is converted to a T at CG's because of C's are often methylated at CG's.Bucket 1 are all of the transition mutations that include CpG mutations. They are WAY overrepresented compared to equal chance. This is the fingerprint of natural mutation.2. Hypothesis: If naturally occurring mutations are responsible for the differences between humans AND between humans and other ape species then we should see this same ratio of mutations.3. Experiment: We compare human genomes to one another and to the genomes of other apes. We count the mutations in each bucket and graph it.4. Conclusion: The graph above shows the same pattern between de novo (new mutations) mutations and differences between human genomes (Human SNP's). We also see the same pattern when we compare human and ape genomes:Our hypothesis is supported. We have scientific evidence that humans and other apes share a common ancestor, and that the differences between our genomes are the product of naturally occuring mutations.I am not assuming common ancestry, nor am I assuming that current processes produced these differences. Instead, I am TESTING to see if this is the cause.

The three tests are:1. Nested hierarchy
2. More differences in introns than in exons
3. More transitions than transversions

I completely agree. I disagree with my fellow atheists when they say evolution disproves Christianity. There are tons and tons of Christian scientists and clergy alike who see no conflict.

At the same time, engineers use the scientific method all of the time in the same way that plumbers, carpenters, and car mechanics use the scientific method. For example, if you hypothesize that a car won't start because of a faulty fuel pump then you can test your hypothesis by replacing the fuel pump, or testing its output. When you get down to it, the scientific method is a combination of troubleshooting and puzzle solving.

I often get the feeling that Creationists think evolution is just something people choose to believe in. At least for me, accepting reality is not a choice. Some people live in a post-fact post-modernist world where reality can be whatever they want it to be, apparently. This is probably where we get the flat Earthers, 5G causes viral infections, moon landing conspiracy theorists, and young Earth creationists. Perhaps some think that intellect and reason are something to be sacrificed on the altar of Christianity.YEC also makes a mockery of the church in general. It's like telling people that they have to believe in a flat Earth in order to be a Christian. As Francis Collins put it:

quote:

---

Professor Darrel Falk has recently pointed out that one should not take the view that young-earth creationism is simply tinkering around the edges of science. If the tenets of young earth creationism were true, basically all of the sciences of geology, cosmology, and biology would utterly collapse. It would be the same as saying 2 plus 2 is actually 5. The tragedy of young-earth creationism is that it takes a relatively recent and extreme view of Genesis, applies to it an unjustified scientific gloss, and then asks sincere and well-meaning seekers to swallow this whole, despite the massive discordance with decades of scientific evidence from multiple disciplines. Is it any wonder that many sadly turn away from faith concluding that they cannot believe in a God who asks for an abandonment of logic and reason?
--Francis Collins, "Faith and the Human Genome"
https://www.asa3.org/ASA/PSCF/2003/PSCF9-03Collins.pdf

---

I think it makes more sense when you are comparing two sequences. For example:
TACTTCGCATGCACTGGTTT :species A
--------*-----------
TACTTCGCTTGCACTGGTTT :species B
Those two species differ at one base in this sequence. So what was the mutation? Well, it could have been a T mutated to an A in species A or an A mutated to a T in species B. That's why this type of mutation is called a T<>A because it could be either one.We also have to take into account that DNA is double stranded with the complementary sequence on the other strand. Since one strand is copied to make the other strand, the mutation could happen on either strand. In the case of the difference above, since A and T are complementary it would be a T<>A no matter what strand the mutation occurred on.
TACTTCGCATGCACTGGTTT
ATGAAGCGTACGTGACCAAA :species A
--------*-----------
TACTTCGCTTGCACTGGTTT
ATGAAGCGAACGTGACCAAA :species B
Let's look at a different mutation.
TACTTCGCATGCACTGGTTT :species A
-----*--------------
TACTTAGCATGCACTGGTTT :species B
Here we have a C to an A or an A to a C. However, this mutation could have happened on the other strand as well.
TACTTCGCATGCACTGGTTT
ATGAAGCGTACGTGACCAAA :species A
-----*--------------
TACTTAGCATGCACTGGTTT
ATGAATCGTACGTGACCAAA :species B
Once we take both strands into account we could have had a T to a G, a G to a T, an A to a C, or a C to an A, or A<>C/T<>G. All four of these mutations would have produced the difference we see between the species, so we lump them together into one bucket, the fourth bucket to be precise.Does that make sense? Thank you for adding that. I thought about including it, but the post was already getting long. As you mention later, this is what we observe in humans. These are the measured ratios of different types of mutations. I just wanted to stress this point. And indeed it does. Stephen Schaffner over at BioLogos did these same comparisons with one tiny twist. He normalized for the 59% bias towards AT content, so he gives a rate instead of a proportion. However, it's the same comparison. He also relabels T<>C/G<>A as transitions, which they are.
credit Testing Common Ancestry: It’s All About the Mutations - BioLogos