|
|
Register | Sign In |
|
QuickSearch
| Thread ▼ Details |
|
Thread Info
|
|
|
| Author | Topic: What Barrier is Stopping Macroevolution? | |||||||||||||||||||||||||||||||||||||||||
|
Taq Member (Idle past 96 days) Posts: 10563 Joined:
|
Some ID/creationists claim that microevolutionary changes can't produce macroevolutionary change. Let's see if that claim stacks up.
First, let's define the scientific terms within the context of the data I am going to present. Microevolution: a single mutation event Macroevolution: the differences between the genomes of two organisms from two different separately created kinds, as proposed by ID/creationists If the ID/creationist argument is correct, then there must be some sort of quantitative difference between microevolution and macroevolution. That is, there should be some sort of objective and demonstrable dividing line between single mutations and the differences seen between two genomes from separately created kinds. What is the process proposed by macroevolution? It is the accumulation of single mutations. Let's start with some short sequences and then work our way up. Step 1We begin with an interbreeding population, otherwise known as a species. They have a shared stretch of DNA in their genome with the sequence ttttttttt. Step 2A huge river changes course and now runs down the middle of the region where this species is found. It is wide and fast enough that individuals aren't able to cross it. We now have two isolated populations, but that shared stretch of DNA still has the same sequence in both populations. We will call them PopA and PopB. PopA: ttttttttt PopB: ttttttttt Step 3In PopA, a substitution mutation occurs in that shared stretch of DNA and spreads through the population of PopA, so now we have: PopA: gtttttttt PopB: ttttttttt Step 4In PopB, the same thing happens. A substitution mutation spreads through the population. Now we have: PopA: gtttttttt PopB: ttttttttc Step 5In PopB, a deletion mutation removes two of the bases from that stretch of DNA and this deletion mutation spreads through the population. We now have: PopA: gtttttttt PopB: tttt--ttc So what would stop this process from happening over and over and over? Let's look at an actual comparison of two genomes. The sequence on top is human DNA sequence from a portion of the mmp3 gene. Below the human DNA sequence is the orthologous DNA from the chimp genome, and between the two sequences are | representing a matching base between the two genomes. There are 11 base differences between the two genomes, 9 substitution mutations and one insertion/deletion (i.e. indel). This gives us an overall similarity of 97.25%.
102836535 acacagccagattccaggttacagggttattctgcttccgatcagataaa 102836584 >>>>>>>>> |||||||||| |||||||||||| |||||||||||||||||||||||||| >>>>>>>>> 098675847 acacagccaggttccaggttacaaggttattctgcttccgatcagataaa 098675896 102836585 ttctccacttgcttggaaactctcatcacctatttctttcttccccaaaa 102836634 >>>>>>>>> ||||||||||||||||||||||| |||||||||||||||||||||||||| >>>>>>>>> 098675897 ttctccacttgcttggaaactctaatcacctatttctttcttccccaaaa 098675946 102836635 atcctcctcccttttccctgcattgcagcctaggaagcacagcaactatt 102836684 >>>>>>>>> |||||||||||||||||||||||||||| ||||||||||||||||||||| >>>>>>>>> 098675947 atcctcctcccttttccctgcattgcagtctaggaagcacagcaactatt 098675996 102836685 tcaaaacaccaggggaccctttagtgctctgcaaacatggtgatcaggtt 102836734 >>>>>>>>> ||||||||||| ||||||||||||||||||||||||||||||||||||| >>>>>>>>> 098675997 tcaaaacaccacaggaccctttagtgctctgcaaacatggtgatcaggtt 098676046 102836735 acctttcaataaagatcatcagcctccacttccttaccttgagtagaaaa 102836784 >>>>>>>>> |||||||||||||||||||||||||||||||||||||||||||||||||| >>>>>>>>> 098676047 acctttcaataaagatcatcagcctccacttccttaccttgagtagaaaa 098676096 102836785 caaaatctttttttttttttaaactttgggcacatggaaaggtaagtatt 102836834 >>>>>>>>> |||||||||||||||||| || ||||||||||||||||||||||||||| >>>>>>>>> 098676097 caaaatctttttttttttata--ctttgggcacatggaaaggtaagtatt 098676144 102836835 tgcaaatgactggcatgggcaatgactgacaactcaggaaagacagacaa 102836884 >>>>>>>>> |||||||||||||||||||||||||||||||||||||||||||||| ||| >>>>>>>>> 098676145 tgcaaatgactggcatgggcaatgactgacaactcaggaaagacaggcaa 098676194 102836885 aaaatctccctgggaattagtagcagcaataagatagggtggaggagaag 102836934 >>>>>>>>> ||||||||||||||| |||||||||||||||||||||||||||||||||| >>>>>>>>> 098676195 aaaatctccctgggagttagtagcagcaataagatagggtggaggagaag 098676244 According to the concept of separately created kinds, the differences between the human and chimp genomes could not be the result of an accumulation of individual mutations. In other words, when they say they don't accept macroevolution they are saying they reject the idea that evolution can produce the differences seen between the human and chimp genomes. So how is that? Which of those differences could not be the result of accumulated mutations like those we see in PopA and PopB? The section of chimp/human DNA I decided to use is most likely intron sequence. I did this because it had more mutations in a small number of bases which keeps the clutter to a minimum. However, if anyone thinks this sequence is inappropriate for the discussion, then they are free to use any section of DNA they like. I am using the UCSC genome browser to look through the latest build of the chimp genome: UCSC Genome Browser Gateway If someone wants to follow the steps I used:I entered "mmp3" into search bar, and then clicked on the "MMP3" hyperlink. I changed the "Human Chain/Net" option to "full" in the Comparative Genomics section, hit refresh, clicked on the bottom alignment within the new track (colored yellow on my screen), and then selected the "DNA sequence alignment" hyperlink on the subsequent page. Clicking on the "together" hyperlink on the subsequent page will give you the view I used above. I am hoping that ID/creationists will cite actual sequence from the human and chimp genomes to illustrate any claims they may have. With the UCSC genome browser, it should be a straightforward process for them to show at least some of the sequence differences they think precludes macroevolution. NOTE: Also, you will need to use dbcodes codes to make these alignments readable on EvC, so use the peek button below to see the codes I used. Specifically, I am using the [code]sequence[/code] dbcode to bracket sequence. You can also use [code]sequence[/code=20] to limit the code box to just 20 visible lines and enable a scroll bar. Edited by Taq, . Edited by Taq, .
|
|||||||||||||||||||||||||||||||||||||||||
|
Taq Member (Idle past 96 days) Posts: 10563 Joined: |
For admin:
The "Biological Evolution" forum would the be most appropriate home for the thread, IMHO. I know there haven't been that many creationists around as of late, but I have always wanted to start a thread like this one, especially given the ease of access to genome sequences in modern times. If the thread starts to die a lonely death, hopefully we can bring this thread back to life if newcomers find it interesting.
|
|||||||||||||||||||||||||||||||||||||||||
|
Admin Director Posts: 13247 From: EvC Forum Joined: |
You can use [code], too, which uses the Courier font by default. It also adds a horizontal scroll bar if it gets wider than the displayed page.
You can get a vertical scrollbar, too. For example, [code=20] adds a vertical scrollbar if there are more than 20 lines. I didn't follow this part:
If humans and chimps were created separately, as claimed by some ID/creationists, then the differences between those two sequences would represent what they would call macroevolution, the supposed thing that the process of microevolution can't produce. If humans and chimps were created separately then wouldn't creationists have no need to explain macroevolution?
|
|||||||||||||||||||||||||||||||||||||||||
|
Taq Member (Idle past 96 days) Posts: 10563 Joined: |
quote: I had issues getting the correct font in the code sections. Need something like courier so the sequences visually line up.
102836535 acacagccagattccaggttacagggttattctgcttccgatcagataaa 102836584 >>>>>>>>> |||||||||| |||||||||||| |||||||||||||||||||||||||| >>>>>>>>> 098675847 acacagccaggttccaggttacaaggttattctgcttccgatcagataaa 098675896 Admin writes: I didn't follow this part: quote:If humans and chimps were created separately then wouldn't creationists have no need to explain macroevolution? Agreed, that is poorly worded. New version:
quote: Does that make more sense? Edited by Taq, .
|
|||||||||||||||||||||||||||||||||||||||||
|
Admin Director Posts: 13247 From: EvC Forum Joined: |
Taq in Message 4 writes: I had issues getting the correct font in the code sections. Need something like courier so the sequences visually line up. Unless there's some obscure bug in play, [code]uses the "Courier New" font by default. This is using [code]with no [face=courier new]:
102836535 acacagccagattccaggttacagggttattctgcttccgatcagataaa 102836584 >>>>>>>>> |||||||||| |||||||||||| |||||||||||||||||||||||||| >>>>>>>>> 098675847 acacagccaggttccaggttacaaggttattctgcttccgatcagataaa 098675896 If you're not seeing that then there must be a bug somewhere that's context dependent, perhaps different browsers.
Does that make more sense? Yep, perfect sense. If you make that substitution in the opening post I'll promote it.
|
|||||||||||||||||||||||||||||||||||||||||
|
Taq Member (Idle past 96 days) Posts: 10563 Joined: |
Admin writes: Unless there's some obscure bug in play It looks like you squashed the bug, as detailed in another thread. I changed everything over to the [code][/code] usage and gave specific instructions on how to use them. As a bonus, I also learned how to use the noparse code.
Yep, perfect sense. If you make that substitution in the opening post I'll promote it. Changes made, and awaiting approval.
|
|||||||||||||||||||||||||||||||||||||||||
|
Admin Director Posts: 13247 From: EvC Forum Joined: |
Thread copied here from the What Barrier is Stopping Macroevolution? thread in the Proposed New Topics forum.
|
|||||||||||||||||||||||||||||||||||||||||
|
AZPaul3 Member Posts: 8924 From: Phoenix Joined:
|
I am hoping that ID/creationists will cite actual sequence from the human and chimp genomes to illustrate any claims they may have. That is a pretty tall order there Taq. Look at your message:
quote: Real ID/creationists do not know what half those words mean. Then you want them to manipulate data? Seriously? That involves math. Now I know they can try to call on Jesus for help but that still means some hard math for someone.“There’s simply no polite way to tell people they’ve dedicated their lives to an illusion,” -Daniel Dennett Stop Tzar Vladimir the Condemned!
|
|||||||||||||||||||||||||||||||||||||||||
|
Taq Member (Idle past 96 days) Posts: 10563 Joined:
|
AZPaul3 writes: Real ID/creationists do not know what half those words mean. Then you want them to manipulate data? Seriously? That involves math. Now I know they can try to call on Jesus for help but that still means some hard math for someone. Since we are saying the quiet parts out loud (and probably won't get any takers anyway), that's what I suspect as well. I am using the most basic terminology used in genetics, so any ID/creationist who claims to be using the same evidence as everyone else should be able to parse what I posted. Surely they have already compared these sequences and found the differences that couldn't evolve, right? If they are using the same evidence as evolutionists then surely they have found specific differences that demonstrate new information, right? [/sarcasm] What you, I, and the rest of the actual scientific community think is that Intelligent Design is nothing more than Christian apologetics with a thinly veiled attempt to disguise it with sciency sounding words. The difference between ID and an actual scientific theory like the theory of evolution is that real scientific theories start with the data. The entire point of science is to explain the data. ID/creationism never deals with the data because that is not the point of ID/creationism. It is Christian apologetics and is meant to make Christians feel justified in rejecting evolution. This is why nearly all ID/creationist arguments boil down to rhetoric and semantics while ignoring the actual data. Of course, I am willing to be proven wrong, hence this thread. Edited by Taq, .
|
|||||||||||||||||||||||||||||||||||||||||
|
Tiktaalik Junior Member (Idle past 284 days) Posts: 4 From: Ancient Canada Joined: |
A little note it's not just individual letter mutations. Some mutations do nothing, some inverse the letters, some duplicate them, and some stop the rest of the chain. Here's more detail Imgflip
|
|||||||||||||||||||||||||||||||||||||||||
|
AZPaul3 Member Posts: 8924 From: Phoenix Joined: |
Bad graphic. There are much better pics available all over the internet. But the issue should be who determined this graphic? Who determined the relationships of these lifeless snippets of chemistry? Why did this relationship come into being?
"There’s simply no polite way to tell people they’ve dedicated their lives to an illusion,” -Daniel Dennett One of man’s greatest achievements was to reach out his mind and teach sand to think. Stop Tzar Vladimir the Condemned!
|
|||||||||||||||||||||||||||||||||||||||||
|
Taq Member (Idle past 96 days) Posts: 10563 Joined: |
Tiktaalik writes: A little note it's not just individual letter mutations. Some mutations do nothing, some inverse the letters, some duplicate them, and some stop the rest of the chain. Sure, there are a whole host of different types of mutations. The main point here is to offer ID/Creationists the chance to look at real sequence data and show us which differences evolution can or can't produce, and why.
|
|||||||||||||||||||||||||||||||||||||||||
|
|
Do Nothing Button
Copyright 2001-2023 by EvC Forum, All Rights Reserved
Version 4.2
Innovative software from Qwixotic © 2026
