Understanding through Discussion


Welcome! You are not logged in. [ Login ]
EvC Forum active members: 88 (8890 total)
Current session began: 
Page Loaded: 02-18-2019 11:09 AM
215 online now:
GDR, PaulK, Percy (Admin), RAZD, ringo, Tangle, Tanypteryx, Theodoric (8 members, 207 visitors)
Chatting now:  Chat room empty
Newest Member: WookieeB
Post Volume:
Total: 847,638 Year: 2,675/19,786 Month: 757/1,918 Week: 44/301 Day: 16/28 Hour: 1/3


Thread  Details

Email This Thread
Newer Topic | Older Topic
  
1
23456
...
17NextFF
Author Topic:   Micro v. Macro Creationist Challenge
Taq
Member
Posts: 7670
Joined: 03-06-2009
Member Rating: 4.3


Message 1 of 252 (809971)
05-22-2017 12:55 PM


For creationists who claim that microevolution and macroevolution are two different things, here is a simple challenge:

Show us a single genetic difference between the human and chimp genome that could not have been produced by known microevolutionary processes in either the chimp or human lineages.

Just for clarity, I am defining a microevolutionary change as a single mutational event (e.g. base substitution, insertion, deletion, transposon insertion, retroviral insertion, or genetic recombination) that is passed on to descendants.

As an example, here is a comparison of portion of the human HNF1 homeobox A gene and the homologous chimp gene:

Query  1     GGCCCTGTGGCAGCCGAGCCATGGTTTCTAAACTGAGCCAGCTGCAGACGGAGCTCCTGG  60
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct 1100 GGCCCTGTGGCAGCCGAGCCATGGTTTCTAAACTGAGCCAGCTGCAGACGGAGCTCCTGG 1159

Query 61 CGGCCCTGCTGGAGTCAGGGCTGAGCAAAGAGGCACTGCTCCAGGCACTGGGTGAGCCGG 120
|||||||||| ||||||||||||||||||||||||||| |||||||||||||||||||||
Sbjct 1160 CGGCCCTGCTCGAGTCAGGGCTGAGCAAAGAGGCACTGATCCAGGCACTGGGTGAGCCGG 1219

Query 121 GGCCCTACCTCCTGGCTGGAGAAGGCCCCCTGGACAAGGGGGAGTCCTGCGGCGGCGGTC 180
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct 1220 GGCCCTACCTCCTGGCTGGAGAAGGCCCCCTGGACAAGGGGGAGTCCTGCGGCGGCGGTC 1279

The human sequence is on top, and the chimp sequence is on the bottom. The "|" symbols indicate where the two sequences are the same. As you can see, there are two base substitutions in the middle row.

Can any creationist give us a single reason why two microevolutionary events could not produce those two base differences? Can creationists point to any different in the chimp and human genomes that could not be produced microevolution?

To admin: Would prefer placement in the Biological Evolution forum.

Edited by Taq, : No reason given.

Edited by Taq, : No reason given.


Replies to this message:
 Message 3 by RAZD, posted 05-22-2017 2:24 PM Taq has not yet responded
 Message 9 by CRR, posted 05-25-2017 12:12 AM Taq has responded
 Message 12 by aristotle, posted 06-16-2017 4:19 AM Taq has responded
 Message 50 by mike the wiz, posted 07-02-2017 12:46 PM Taq has responded
 Message 74 by CRR, posted 07-09-2017 7:59 PM Taq has responded

  
AdminNosy
Administrator
Posts: 4754
From: Vancouver, BC, Canada
Joined: 11-11-2003


Message 2 of 252 (809973)
05-22-2017 2:15 PM


Thread Copied from Proposed New Topics Forum
Thread copied here from the Micro v. Macro Creationist Challenge thread in the Proposed New Topics forum.
  
RAZD
Member
Posts: 19732
From: the other end of the sidewalk
Joined: 03-14-2004
Member Rating: 5.0


Message 3 of 252 (809974)
05-22-2017 2:24 PM
Reply to: Message 1 by Taq
05-22-2017 12:55 PM


For creationists who claim that microevolution and macroevolution are two different things, here is a simple challenge:

Show us a single genetic difference between the human and chimp genome that could not have been produced by known microevolutionary processes in either the chimp or human lineages.

But that didn't produce a new 'kind' ... oh wait ...


we are limited in our ability to understand
by our ability to understand
RebelAmerican☆Zen☯Deist
... to learn ... to think ... to live ... to laugh ...
to share.


• • • Join the effort to solve medical problems, AIDS/HIV, Cancer and more with Team EvC! (click) • • •

This message is a reply to:
 Message 1 by Taq, posted 05-22-2017 12:55 PM Taq has not yet responded

  
Taq
Member
Posts: 7670
Joined: 03-06-2009
Member Rating: 4.3


(1)
Message 4 of 252 (810117)
05-23-2017 4:59 PM


Chimp or Human Mutations?
Just for fun, I compared the chimp sequence to the gorilla sequence to figure out if those two mutations occurred in the chimp or human lineages. If the chimp and gorilla sequence is the same then the mutation happened in the human lineage. If the human and gorilla sequence is the same, then the mutation occurred in the chimp lineage.

As it turns out, the first mutation in the opening post is specific to the chimp lineage, and the second mutation is specific to the human lineage (using BLASTn).


Replies to this message:
 Message 5 by RAZD, posted 05-24-2017 7:54 AM Taq has responded

  
RAZD
Member
Posts: 19732
From: the other end of the sidewalk
Joined: 03-14-2004
Member Rating: 5.0


Message 5 of 252 (810143)
05-24-2017 7:54 AM
Reply to: Message 4 by Taq
05-23-2017 4:59 PM


Re: Chimp or Human Mutations?
Just for fun, I compared the chimp sequence to the gorilla sequence to figure out if those two mutations occurred in the chimp or human lineages. If the chimp and gorilla sequence is the same then the mutation happened in the human lineage. If the human and gorilla sequence is the same, then the mutation occurred in the chimp lineage.

As it turns out, the first mutation in the opening post is specific to the chimp lineage, and the second mutation is specific to the human lineage (using BLASTn).

Nicely done.

Are you sure about those time stamps at the bottom? I thought human/chimp split was ~10MYA, and this puts the split square in the lap of Ardipithecus ramidus and Ardipithecus kadabba:

quote:
Ardipithecus is a genus of an extinct hominine that lived during Late Miocene and Early Pliocene in Afar Depression, Ethiopia. Originally described as one of the earliest ancestors of humans after they diverged from the main ape lineage, the relation of this genus to human ancestors and whether it is a hominin is now a matter of debate.[1] Two fossil species are described in the literature: A. ramidus, which lived about 4.4 million years ago[2] during the early Pliocene, and A. kadabba, dated to approximately 5.6 million years ago (late Miocene).[3] Behavioral analysis showed that Ardipithecus could be very similar to chimpanzees, indicating that the early human ancestors were very chimpanzee-like in behaviour.[1]

and it puts the gorilla split in the lap of Sahelanthropus tchadensis:

quote:
Sahelanthropus tchadensis is an extinct homininae species (and is probably the ancestor to Orrorin) that is dated to about 7 million years ago, during the Miocene epoch, possibly very close to the time of the chimpanzee–human divergence. Few specimens are known, other than the partial skull nicknamed Toumaï ("hope of life").

Exciting times.

Enjoy


we are limited in our ability to understand
by our ability to understand
RebelAmerican☆Zen☯Deist
... to learn ... to think ... to live ... to laugh ...
to share.


• • • Join the effort to solve medical problems, AIDS/HIV, Cancer and more with Team EvC! (click) • • •

This message is a reply to:
 Message 4 by Taq, posted 05-23-2017 4:59 PM Taq has responded

Replies to this message:
 Message 6 by Taq, posted 05-24-2017 10:52 AM RAZD has responded

  
Taq
Member
Posts: 7670
Joined: 03-06-2009
Member Rating: 4.3


Message 6 of 252 (810160)
05-24-2017 10:52 AM
Reply to: Message 5 by RAZD
05-24-2017 7:54 AM


Re: Chimp or Human Mutations?
RAZD writes:

Are you sure about those time stamps at the bottom? I thought human/chimp split was ~10MYA, and this puts the split square in the lap of Ardipithecus ramidus and Ardipithecus kadabba:

A quick scan of a Google Scholar search seems to show that recent papers are still using divergence times of around 4-6 million years, with some papers going even as high as 8 MYA. I would suspect that 10 MYA would be an outlier with respect to the consensus.

As to Ardipithecus, it may push the common ancestor more towards the 6 MYA side of the equation than the 4 MYA.


This message is a reply to:
 Message 5 by RAZD, posted 05-24-2017 7:54 AM RAZD has responded

Replies to this message:
 Message 7 by RAZD, posted 05-24-2017 2:57 PM Taq has responded

  
RAZD
Member
Posts: 19732
From: the other end of the sidewalk
Joined: 03-14-2004
Member Rating: 5.0


Message 7 of 252 (810170)
05-24-2017 2:57 PM
Reply to: Message 6 by Taq
05-24-2017 10:52 AM


Re: Chimp or Human Mutations?
A quick scan of a Google Scholar search seems to show that recent papers are still using divergence times of around 4-6 million years, with some papers going even as high as 8 MYA. I would suspect that 10 MYA would be an outlier with respect to the consensus.

Or it is just old. I remember speculating when Sahelanthropus tchadensis was found that it could be the common ancestor with chimps.

As to Ardipithecus, it may push the common ancestor more towards the 6 MYA side of the equation than the 4 MYA

Or it (or a close relative) is the common ancestor.

We know already that it is intermediate in form and that "Behavioral analysis showed that Ardipithecus could be very similar to chimpanzees, indicating that the early human ancestors were very chimpanzee-like in behaviour.[1]"

See The story of Bones and Dogs and Humans:

quote:
Let's put Ardi in a line-up with Humans, Australopithicus and Chimps (note skeletons not scaled the same):


The major difference in appearance I see being the hip bones, but not out of a reasonable realm for evolution.

There are some missing bones for the Ardi reconstruction, so new finds will be needed to fill in that gap in our knowledge.

Enjoy


we are limited in our ability to understand
by our ability to understand
RebelAmerican☆Zen☯Deist
... to learn ... to think ... to live ... to laugh ...
to share.


• • • Join the effort to solve medical problems, AIDS/HIV, Cancer and more with Team EvC! (click) • • •

This message is a reply to:
 Message 6 by Taq, posted 05-24-2017 10:52 AM Taq has responded

Replies to this message:
 Message 8 by Taq, posted 05-24-2017 4:30 PM RAZD has acknowledged this reply

  
Taq
Member
Posts: 7670
Joined: 03-06-2009
Member Rating: 4.3


(1)
Message 8 of 252 (810171)
05-24-2017 4:30 PM
Reply to: Message 7 by RAZD
05-24-2017 2:57 PM


Re: Chimp or Human Mutations?
RAZD writes:

Or it is just old. I remember speculating when Sahelanthropus tchadensis was found that it could be the common ancestor with chimps.

Could be.

For the time being, however, the actual dates are somewhat irrelevant. What matters for the gorilla/chimp/human triad is that the chimp/human lineage diverged from the gorilla lineage followed by humans and chimps diverging into their own lineages. This is what allows us to model the common ancestral genome and assign mutations to either the human or chimp lineage. Of course, incomplete lineage sorting can cause some inconsistencies, but for now we are going to go with a simple model.


This message is a reply to:
 Message 7 by RAZD, posted 05-24-2017 2:57 PM RAZD has acknowledged this reply

  
CRR
Member (Idle past 287 days)
Posts: 579
From: Australia
Joined: 10-19-2016


Message 9 of 252 (810187)
05-25-2017 12:12 AM
Reply to: Message 1 by Taq
05-22-2017 12:55 PM


No Contest
Since you have put no bounds on the starting assumptions and you have made your definition of microevolution so broad, anything could be "explained".

Why not first start a thread on the definitions and differences between microevolution and macroevolution?


This message is a reply to:
 Message 1 by Taq, posted 05-22-2017 12:55 PM Taq has responded

Replies to this message:
 Message 10 by RAZD, posted 05-25-2017 6:28 AM CRR has not yet responded
 Message 11 by Taq, posted 05-25-2017 11:00 AM CRR has not yet responded
 Message 77 by CRR, posted 07-09-2017 8:42 PM CRR has not yet responded

  
RAZD
Member
Posts: 19732
From: the other end of the sidewalk
Joined: 03-14-2004
Member Rating: 5.0


Message 10 of 252 (810193)
05-25-2017 6:28 AM
Reply to: Message 9 by CRR
05-25-2017 12:12 AM


Re: No Contest
Why not first start a thread on the definitions and differences between microevolution and macroevolution?

Several threads on this issue, see MACROevolution vs MICROevolution - what is it? for example. It starts with creationist misinformed definitions.

Enjoy


we are limited in our ability to understand
by our ability to understand
RebelAmerican☆Zen☯Deist
... to learn ... to think ... to live ... to laugh ...
to share.


• • • Join the effort to solve medical problems, AIDS/HIV, Cancer and more with Team EvC! (click) • • •

This message is a reply to:
 Message 9 by CRR, posted 05-25-2017 12:12 AM CRR has not yet responded

  
Taq
Member
Posts: 7670
Joined: 03-06-2009
Member Rating: 4.3


(1)
Message 11 of 252 (810206)
05-25-2017 11:00 AM
Reply to: Message 9 by CRR
05-25-2017 12:12 AM


Re: No Contest
CRR writes:

Since you have put no bounds on the starting assumptions and you have made your definition of microevolution so broad, anything could be "explained".

The bounds are the chimp and human genomes. What I am asking is if humans and chimps share a common ancestor, which genetic differences between them are you saying couldn't be produced by the observed mechanisms of mutagenesis.

mutagenesis = production of mutations

The major types of mutations are substitutions, insertions, deletions, transposon or retroviral insertion, and genetic recombination. A google search for those terms should give you all the definitions and descriptions that you need. If you have questions, please ask.

Microevolution occurs when a single mutation is passed on to subsequent generations and either increases or decreases in frequency over multiple generations.

Macroevolution occurs when two separate populations do not freely interbreed causing different microevolutionary events to accumulate in each of populations. This causes the populations to become different from one another over time, as is the case for humans and chimps.

Creationists claim that microevolutionary events can not accumulate to the point where they produce the genetic differences seen between separate species. I am using the human and chimp genomes as our specific example, and challenging creationists to point to a single genetic difference between the chimp and human genomes that could not be produced by a microevolutionary event. They must also explain what would stop mutations from accumulating over time since every generation is born with new mutations.


This message is a reply to:
 Message 9 by CRR, posted 05-25-2017 12:12 AM CRR has not yet responded

  
aristotle
Junior Member (Idle past 521 days)
Posts: 16
Joined: 06-15-2017


Message 12 of 252 (812337)
06-16-2017 4:19 AM
Reply to: Message 1 by Taq
05-22-2017 12:55 PM


Do you truly think it fair expecting creationists to prove the changes were not the result of mutations, when you can't prove that they were?

That asked, the chances of the mutations required between human and primate, occurring in the right gene and often enough in the population to change the genome of the entire species, are next to naught.

By themselves, random base substitutions, and deletions, resulting in beneficial changes to the organism, do not occur frequently enough.

When the assumption was made in the 1930s that point mutations could be the cause of an organism's progress, they could not properly calculate the chances of that happening. We can forgive them, for this assumption.

We now know how tiny the odds are, and so can not be forgiven for making the same mistake.

As for genetic insertions and recombinations, while occurring fairly often, aren't random processes like mutations, but are functions inherent in the genome.

Doctor Shapiro states: "In the pre-DNA era, students were all taught that genetic change is random and accidental. Because the molecular details were inaccessible, this was the
default assumption. But once we learned about DNA carrying hereditary
information, we could research the
details of how changes occur. We no
longer needed to assume. We could
investigate."

As his article describes, genetic recombination is not at all random: http://m.huffpost.com/us/entry/1743647

Regards, aristotle

Edited by aristotle, : No reason given.


"I have learned from my own embarrassing experience how easy it is to concoct remarkably persuasive Darwinian explanations that evaporate on closer inspection." - Daniel Dennet

This message is a reply to:
 Message 1 by Taq, posted 05-22-2017 12:55 PM Taq has responded

Replies to this message:
 Message 13 by Tangle, posted 06-16-2017 4:34 AM aristotle has responded
 Message 14 by RAZD, posted 06-16-2017 6:24 AM aristotle has responded
 Message 17 by JonF, posted 06-16-2017 7:36 AM aristotle has responded
 Message 24 by Taq, posted 06-16-2017 4:48 PM aristotle has not yet responded
 Message 31 by caffeine, posted 06-23-2017 4:35 PM aristotle has not yet responded

  
Tangle
Member
Posts: 6611
From: UK
Joined: 10-07-2011
Member Rating: 3.9


(1)
Message 13 of 252 (812340)
06-16-2017 4:34 AM
Reply to: Message 12 by aristotle
06-16-2017 4:19 AM


Aristotle writes:

Do you truly think it fair expecting creationists to prove the changes were not the result of mutations, when you can't prove that they were?

We don't expect creationists to be able to prove anything - our expections are very, very low based on prior observation.

But yes, if you could show that mutations do not contribute positively to the evolutionary process by using actual research - and not simply quote mining - that would be a very valuable addition to science.

Btw, it's always useful to know with a newbie creationist, how old do you think the earth is?


Je suis Charlie. Je suis Ahmed. Je suis Juif. Je suis Parisien. I am Mancunian. I am Brum. I am London.

"Life, don't talk to me about life" - Marvin the Paranoid Android

"Science adjusts it's views based on what's observed.
Faith is the denial of observation so that Belief can be preserved."
- Tim Minchin, in his beat poem, Storm.


This message is a reply to:
 Message 12 by aristotle, posted 06-16-2017 4:19 AM aristotle has responded

Replies to this message:
 Message 15 by aristotle, posted 06-16-2017 7:01 AM Tangle has responded
 Message 44 by ICANT, posted 06-27-2017 2:19 PM Tangle has responded

  
RAZD
Member
Posts: 19732
From: the other end of the sidewalk
Joined: 03-14-2004
Member Rating: 5.0


Message 14 of 252 (812352)
06-16-2017 6:24 AM
Reply to: Message 12 by aristotle
06-16-2017 4:19 AM


Do you truly think it fair expecting creationists to prove the changes were not the result of mutations, when you can't prove that they were?

That's not quite what he asked in Message 1. He actually asked:

Show us a single genetic difference between the human and chimp genome that could not have been produced by known microevolutionary processes in either the chimp or human lineages.

eg - compare the genomes and show which differences could not occur through mutations of the type observed in organisms today.

Do you see the difference?

That asked, the chances of the mutations required between human and primate, occurring in the right gene and often enough in the population to change the genome of the entire species, are next to naught.

By themselves, random base substitutions, and deletions, resulting in beneficial changes to the organism, do not occur frequently enough.

Do you agree that domestic dogs and cats and cows and sheep show a wide variety of traits and sizes to the point where some dogs are remarkably different from other dogs?

That's a lot of genetic changes and a fair proportion of them are documented by historical observation in recent (geoplogical) years.

If we compared the skeletons of those dogs to one another, would we see more or less variation than see here:

Inquiring minds want to know.

Enjoy

... as you are new here, some posting tips:

type [qs]quotes are easy[/qs] and it becomes:

quotes are easy

and you can type [qs=RAZD]quotes are easy[/qs] and it becomes:

RAZD writes:

quotes are easy

or type [quote]quotes are easy[/quote] and it becomes:

quote:
quotes are easy

also check out (help) links on any formatting questions when in the reply window.

For other formatting tips see Posting Tips
For a quick overview see EvC Forum Primer
If you have problems with replies see Report Discussion Problems Here 3.0


we are limited in our ability to understand
by our ability to understand
RebelAmerican☆Zen☯Deist
... to learn ... to think ... to live ... to laugh ...
to share.


• • • Join the effort to solve medical problems, AIDS/HIV, Cancer and more with Team EvC! (click) • • •

This message is a reply to:
 Message 12 by aristotle, posted 06-16-2017 4:19 AM aristotle has responded

Replies to this message:
 Message 16 by aristotle, posted 06-16-2017 7:09 AM RAZD has responded

  
aristotle
Junior Member (Idle past 521 days)
Posts: 16
Joined: 06-15-2017


(1)
Message 15 of 252 (812354)
06-16-2017 7:01 AM
Reply to: Message 13 by Tangle
06-16-2017 4:34 AM


We don't expect creationists to be able to
prove anything - our expections are very,
very low based on prior observation.

But yes, if you could show that mutations do not contribute positively to the evolutionary process by using actual research - and not simply quote mining - that would be a very valuable addition to science.

So posting one quote is 'quote mining'?! Okay then

Btw, the quote was not about mutations, it was about recombinations

Again, I ask you how you can ask me to show that mutations were not the cause of our evolution, when you can't prove that they did?

I never asked you to prove that the mutations evolved us, you chose to be an Evolutionist, but then at least have the courtesy to try and prove your own assumptions, instead of just expecting others to disprove them.

Btw, it's always useful to know with a newbie
creationist, how old do you think the earth is?

Again you pigeonhole me as a creationist, it shows your extremely narrow view. I don't know how old the earth is, and I'm certainly not as arrogant as evolutionists to think that I know how life was created.

Regards, aristotle


"I have learned from my own embarrassing experience how easy it is to concoct remarkably persuasive Darwinian explanations that evaporate on closer inspection." - Daniel Dennet

This message is a reply to:
 Message 13 by Tangle, posted 06-16-2017 4:34 AM Tangle has responded

Replies to this message:
 Message 23 by Tangle, posted 06-16-2017 11:54 AM aristotle has not yet responded
 Message 25 by Taq, posted 06-16-2017 4:52 PM aristotle has not yet responded

  
1
23456
...
17NextFF
Newer Topic | Older Topic
Jump to:


Copyright 2001-2018 by EvC Forum, All Rights Reserved

™ Version 4.0 Beta
Innovative software from Qwixotic © 2019