Understanding through Discussion


Welcome! You are not logged in. [ Login ]
EvC Forum active members: 79 (8897 total)
Current session began: 
Page Loaded: 03-20-2019 7:35 AM
138 online now:
kjsimons, Percy (Admin) (2 members, 136 visitors)
Chatting now:  Chat room empty
Newest Member: WookieeB
Post Volume:
Total: 848,478 Year: 3,515/19,786 Month: 510/1,087 Week: 100/212 Day: 16/14 Hour: 0/0


Thread  Details

Email This Thread
Newer Topic | Older Topic
  
Prev1
...
56
7
891011Next
Author Topic:   Genetics and Human Brain Evolution
Wounded King
Member (Idle past 2169 days)
Posts: 4149
From: Edinburgh, Scotland
Joined: 04-09-2003


Message 91 of 157 (360222)
10-31-2006 6:22 PM
Reply to: Message 90 by eggasai
10-31-2006 5:29 PM


Wilful ignorance
Then I am informed by unanimous consent of scientific professionals I don't have a clue about the basics.

And from this you conclude that everyone is prejudiced against you because you are a creationist? Is there no other conceivable reason that coms to your mind? No, I guess not.

TTFN,

WK

Edited by Wounded King, : because I forgot, 'i before e except after c where the sound is /i:/'


This message is a reply to:
 Message 90 by eggasai, posted 10-31-2006 5:29 PM eggasai has responded

Replies to this message:
 Message 96 by eggasai, posted 11-01-2006 9:32 PM Wounded King has not yet responded

    
kuresu
Member (Idle past 587 days)
Posts: 2544
From: boulder, colorado
Joined: 03-24-2006


Message 92 of 157 (360269)
10-31-2006 8:46 PM
Reply to: Message 90 by eggasai
10-31-2006 5:29 PM


Another basic comprehension failure and a lie
this has nothing to do with your all's genetics contest directly, however . . .

1)whenever an organism is put into a new habitat, it changes--one of the cause of speciation. In this case, the chimps stuck with the trees, while we went to the grasslands. we were adapted, as the chimps are, quite well for tree life.

2) our brain size did not increase because we left Africa. if you'll note, our direct anscestors came from Africa no later than 40,000 yrs ago. (homo sapiens left africa at this time, homo erectus left at the time you state. we are decesended from the african homo erectus*)

3)that last statement, about the "stasis" of chimps, is false. Mutations do occur in them. So they will have changed. As a side note, they haven't really moved out of their niche, so they have remained relatively the same, but . . .

By the way, did you ever notice that none of the fossils found in equtaorial Africa are ape ancestors, only hominids?

really, well I never . . .

bull.

quote:
The three primates called Bugtipithecus inexpectans, Phileosimias kamali, and Phileosimias brahuiorum all date back to the Oligocene some 30 million years ago - when monkeys dominated only Africa. These were small lemur-like catarrhines that prospered in an ancient tropical rainforest
http://en.wikipedia.org/wiki/Eosimias

while the fossils listed in this article were found in Pakistan, you'll notice that it says that monkeys were in in Africa. And monkeys are not apes. This logically means that we should find monkey fossils in Africa.

quote:
Victoriapithecus macinnesi was a primate. It was described from a single fossil specimen, the oldest Old World monkey skull fossil. It was discovered near Lake Victoria in Kenya
http://en.wikipedia.org/wiki/Victoriapithecus

and what's this!? a monkey fossil, actually in Africa.

And as to the assertion that all these ape fossils are hominid ancestors, what of:

quote:
However, chimpanzee fossils have now been reported from Kenya
However, chimpanzee fossils have now been reported from Kenya

you'll note that this is a chimp fossil, and chimps are not our ancestors, and they are apes.


Want to help give back to the world community? Did you know that your computer can help? Join the newest TeamEvC Climate Modelling to help improve climate predictions for a better tomorrow.
This message is a reply to:
 Message 90 by eggasai, posted 10-31-2006 5:29 PM eggasai has not yet responded

    
CACTUSJACKmankin
Member (Idle past 4348 days)
Posts: 48
Joined: 04-22-2006


Message 93 of 157 (360363)
11-01-2006 9:16 AM
Reply to: Message 90 by eggasai
10-31-2006 5:29 PM


Re: Getting the numbers right
quote:
The one thing that has fascintaed me about all of this is the intensity everyone from a freshman Biology 101 student to a PHD has in common is that they find creationism detestable.

That's because creationism is antiscientific, it rejects much of what we know about biology, geology, astronomy, chemistry, and even physics.

quote:
What I don't buy is the constant unsubstantiated assertion that genetics and single common ancesotry blends together in dovetail fashion.

quote:
That doesn't stop anyone of you from preaching common ancestry like it's an inerrent canon of biology.

If genetics proves heredity for parents and children why is it so hard to extrapolate that to species and so on? Especially when fossil and comparative physiological evidence backs up those conclusions. The redundancy of the amino acid code is actually one of if not the strongest evidences for common ancestory because it results in a situation where design is irrelevant because the codes are functionally redundant. The more similar your protein sequences are, the more closely related you are.

quote:
I only ask because the LCA was supposedly 5-7 mya and our ancestors did not actually leave Africa until about 1.5 mya.
Fossil, genetic, and molecular biological evidence puts the common ancestor of all modern humans in africa about 70kya. The human brain would have had to reach its modern size and capacity around this time, certainly before the first migrations from africa. The 1.5 mya figure may have to do with the migrations of homo erectus which spanned much of africa, europe, and asia. These would have been relatives of our ancestors but not our direct ancestors.
This message is a reply to:
 Message 90 by eggasai, posted 10-31-2006 5:29 PM eggasai has not yet responded

Replies to this message:
 Message 95 by RAZD, posted 11-01-2006 9:17 PM CACTUSJACKmankin has not yet responded

  
Wounded King
Member (Idle past 2169 days)
Posts: 4149
From: Edinburgh, Scotland
Joined: 04-09-2003


Message 94 of 157 (360365)
11-01-2006 9:19 AM
Reply to: Message 88 by sfs
10-31-2006 3:51 PM


Now see what you've done!!!
Naughty sfs!!

Barging in here, without as much as a 'by your leave', and scaring off our creationists.

You're hardly ever in, you don't call to let us know where you are but you turn up like the proverbial bad penny to frighten the latest squeaky rubber creationist bit substitute, for our champing horse like teeth, back into the undergrowth.

I am most cross with you.

TTFN,

WK

Edited by Wounded King, : Basically because I have the typing aptitude of an untrained monkey


This message is a reply to:
 Message 88 by sfs, posted 10-31-2006 3:51 PM sfs has responded

Replies to this message:
 Message 98 by eggasai, posted 11-01-2006 10:11 PM Wounded King has responded
 Message 121 by sfs, posted 11-02-2006 11:10 PM Wounded King has not yet responded

    
RAZD
Member
Posts: 19754
From: the other end of the sidewalk
Joined: 03-14-2004
Member Rating: 5.0


Message 95 of 157 (360587)
11-01-2006 9:17 PM
Reply to: Message 93 by CACTUSJACKmankin
11-01-2006 9:16 AM


Re: Getting the numbers right
small correction

the common ancestor of all modern humans in africa about 70kya.

Don't confuse a species human LCA with the LCA for separation of our species from a previous species. (LCA is such a misconception :rolleyes:). The LCA within a species will always be able to be substantially younger than the LCA for that species and their closest cousin species.

If we are talking about the genetic pool that included the oldest known Homo sapiens, when our species may have branched from other Homo species, then make that 160,000 to 200,000 years ago (minimum). In Ethiopia:
http://www.berkeley.edu/news/media/releases/2003/06/11_idaltu.shtml
http://www.nature.com/news/2005/050214/full/050214-10.html
(You'll have to sign in to access the second).

That doesn't change the fact that this is long after both Homo neanderthalis and Homo erectus had emigrated into europe and asia.

Nor does this have any bearing with how much more ancient the last common ancestor with chimpanzees lived. In africa.

Having a LCA younger than the emigration from africa WOULD be a problem.

Enjoy.


Join the effort to unravel {AIDS/HIV} {Protenes} and {Cancer} with Team EvC! (click)

we are limited in our ability to understand
by our ability to understand

RebelAAmericanOZen[Deist
... to learn ... to think ... to live ... to laugh ...
to share.


This message is a reply to:
 Message 93 by CACTUSJACKmankin, posted 11-01-2006 9:16 AM CACTUSJACKmankin has not yet responded

  
eggasai
Inactive Member


Message 96 of 157 (360589)
11-01-2006 9:32 PM
Reply to: Message 91 by Wounded King
10-31-2006 6:22 PM


Wilful ignorance is an understatement
I'll tell you what the problem is, you guys don't want people to know what the actual divergence is. That's why the semantical shell game.
This message is a reply to:
 Message 91 by Wounded King, posted 10-31-2006 6:22 PM Wounded King has not yet responded

  
RAZD
Member
Posts: 19754
From: the other end of the sidewalk
Joined: 03-14-2004
Member Rating: 5.0


Message 97 of 157 (360591)
11-01-2006 9:37 PM
Reply to: Message 90 by eggasai
10-31-2006 5:29 PM


farewell?
I have read the books, webpages, papers and endless posts like the one in this thread for better then two years now. Then I am informed by unanimous consent of scientific professionals I don't have a clue about the basics.

I'm through with it.

I guess this means there will be no answer to the question of sexual selection (Message 11, Message 16, Message 33, and Message 60) providing a mechanism for accelerated selection of certain "desired" features, the correlation of sexual selection types of evidence with humans, demonstrating sexual selection has been and continues to be a shaping force on human evolution ... including selection for more creative brains ...

and further that we won' t have that promised (Message 42) "walk through the shelf of skulls" that show the transition in skull sizes with no sudden jump (Message 33), to see you attempt to "debunk this optical illusion with substantive details" ... when it would be so easy to provide those "details" should they really exist.

"So much for the gay art of cloud riding ..."

... denial (or running away when you can't refute it) does not make evidence go away.

Enjoy.


Join the effort to unravel {AIDS/HIV} {Protenes} and {Cancer} with Team EvC! (click)

we are limited in our ability to understand
by our ability to understand

RebelAAmericanOZen[Deist
... to learn ... to think ... to live ... to laugh ...
to share.


This message is a reply to:
 Message 90 by eggasai, posted 10-31-2006 5:29 PM eggasai has not yet responded

  
eggasai
Inactive Member


Message 98 of 157 (360594)
11-01-2006 10:11 PM
Reply to: Message 94 by Wounded King
11-01-2006 9:19 AM


Re: Now see what you've done!!!
Just for clarification, I'm giving up the Creation/evolution because I really get tired of the duplicity. There is a list as long as you arm throughout this thread of disingenuise statements but this one gets the booby prize of all times. You see, all this time I thought we were looking at a clash of worldviews, differences of opinion on the substantive reasons for the evidence. I don't think so anymore.

I can do this as long as I can find the time for it. I'll just give up creationism and start studying another kind of evidential apologetics. The names changes and the source material is different but the arguements allways go in the same circles. That's not why I am giving up the Crevo thing, it's not that I'm scared, it's that I am finally disgusted. I don't think this is an honest difference of opinion anymore, I think evolutionists are liars.

Time says that we are 98%-99% chimpanzee in our DNA and they know we are not. Nature in announcing the Chimpanzee Genome paper says we are 98% chimpanzee in our DNA and the paper says we are not. Then when I bring up the indels with one of the staff scientists who worked on the paper I get this:

quote:
No, like counting all the base pairs in the indels and applying them to the mutation rate as measured in mutation events, which is what you've just done here. The 2x10^-8/bp/generation is the number of mutation events, not the number of base pairs. (It's also just the single-base substitution rate, but that's less important.) It doesn't matter how many times you make that comparison: it will be wrong every time you do.

He gives this formula and enters bp in the equation, it seems pretty obvious that it stands for base pair. Then he says it's not base pairs it's the single base substitution rate. No matter how many times I measure divergence by base pairs I will be wrong because bp is not base pairs even though that is how he has been using it for almost a year.

You guys do this and do this and do this. I don't think you are trying to correct an error in my posts I think you are trying to create an error in my thinking. I don't mind an honest difference of opinion or the whole board coming against me just as hard as they can, I love that. Disingenuise double talk and the semantical slight of hand you guys are using disgusts me. At least at one time I respected evolutionists who had credentials, now I think you are all the same, evolution isn't science, suppostion or even semantical wordplay. It's a lie.

Edited by eggasai, : Didn't want there to be any mistake about what I was saying


This message is a reply to:
 Message 94 by Wounded King, posted 11-01-2006 9:19 AM Wounded King has responded

Replies to this message:
 Message 100 by Wounded King, posted 11-02-2006 2:21 AM eggasai has responded
 Message 101 by Wounded King, posted 11-02-2006 2:45 AM eggasai has not yet responded

  
kuresu
Member (Idle past 587 days)
Posts: 2544
From: boulder, colorado
Joined: 03-24-2006


Message 99 of 157 (360617)
11-02-2006 1:03 AM


what is it with the recent string of pity parties on how "twisted" evolutionits are in debating creationists lately? First buz, and now this dude.

to eggassai--we're not lying about things. honest to god. we don't intentionally misinterpret things to support our "false theory". most of the time, we do know what we're talking about (in our respective fields). there's no conspiracy, no purposeful misleading. so instead of insulting us by calling us liars (which is against the forum rules that is--the whole insulting thing), can you at least try to give a real criticism, instead of labelling us all liars purposely misleading others?


Want to help give back to the world community? Did you know that your computer can help? Join the newest TeamEvC Climate Modelling to help improve climate predictions for a better tomorrow.
Replies to this message:
 Message 102 by eggasai, posted 11-02-2006 5:48 AM kuresu has not yet responded

    
Wounded King
Member (Idle past 2169 days)
Posts: 4149
From: Edinburgh, Scotland
Joined: 04-09-2003


Message 100 of 157 (360629)
11-02-2006 2:21 AM
Reply to: Message 98 by eggasai
11-01-2006 10:11 PM


Re: Now see what you've done!!!
Disingenuise double talk and the semantical slight of hand you guys are using disgusts me.

Fine then lets do away with semantics and look at some raw data, I'll repost the exercise I suggested earlier.

This link will take you to the entrez nucleotide page for the Har1 sequences from the paper we were discussing. You will note that both sequences are identified as 'non-protein-coding RNA'.

If we click on the second sequence there Har1A then you will be taken to the sequence of the highly accelerated region.

If you scroll down to just before the actual sequence starts you will find a 'misc feature' annotation link which is the actual 'highly conserved' 118bp sequence.

If you copy that sequence and put it into Entrez's ORF finder program it won't find a single one. If you take the whole Har1 region and put it through ORF finder you will see a number of possible ORF's and the nucleotide ranges they span, none of these ORFs span the region from 851-968 within which the highly conserved region is found.

If there is a mistake here then please show me where it is, if not then please finally admit that this sequence does not functionally code for any protein sequence whatsoever!!

This exercise shouldn't take more than a couple of minutes at most so please go through it and tell me what you are seeing that neither I, the ORF-finder program nor the authors of the original paper can see.

No semantics here, just a chance for you to analyse the raw data yourself and come to a conclusion.

TTFN,

WK


This message is a reply to:
 Message 98 by eggasai, posted 11-01-2006 10:11 PM eggasai has responded

Replies to this message:
 Message 103 by eggasai, posted 11-02-2006 6:43 AM Wounded King has responded

    
Wounded King
Member (Idle past 2169 days)
Posts: 4149
From: Edinburgh, Scotland
Joined: 04-09-2003


Message 101 of 157 (360633)
11-02-2006 2:45 AM
Reply to: Message 98 by eggasai
11-01-2006 10:11 PM


Cross-purposes
He gives this formula and enters bp in the equation, it seems pretty obvious that it stands for base pair. Then he says it's not base pairs it's the single base substitution rate. No matter how many times I measure divergence by base pairs I will be wrong because bp is not base pairs even though that is how he has been using it for almost a year.

The rate is mutations per length of genome per period of time.
2x10^-8 mutations per base pair of length per generation. So if those mutations, as the indels do, affect more than 1bp (18-300bp average, doesn't matter which really) at a time then using that mutation rate figure to calculate the actual basepair divergence will not work.

The second point was that that was not actually an accurate measure of the mutation rate overall but of the mutation rate for single base substitutions specifically. This means that were there only single base substitutions occurring then you would be able to use the formula as you wish to, but since we know there are indels, inversions and other mutations which affect more than 1bp at a time such an approach will not give you an accurate figure.

You can measure the divergence in bp as much as you want, but using that figure alone coupled with a single nucleotide substitution based mutation rate which fails to take into account substantial indels will give you an inflated needed rate of mutation. Most of the time for a single protein coding gene this approach would be fine, but over the whole genome where there are such large scale muations evident it would be innaccurate.

Here is an example:

Sequence: atgtgggttagtgcgcgttgaaggccgtgattagcgcgcgcgtatgatc

Mutant 1: atgcgagttagtgcgcgttgaaggttgtgattagcgcgtacgtatgatc

Mutant 2: atgtgggttagtgcgcgttgaaaaaaaaaaaaaaaaaaaaaaggccgtgattagcgcgcgcgtatgatc

Mutant 1 has 6 single nucleotide substitions, mutant 2 has a single insertion of 20 nucleotides. Using the method you have been proposing that single insertion would require an increase in the neccessary mutations fixed or mutations per generation even though it is only a single mutation compared to the 6 in mutant 1.

Given the highly variable nature of the size of indels all you could really hope to produce is a more accurate rate of mutation, regardless of type, but this will never tell you how many bps are being changed per bp of premutational genome length. All you can tell is how many mutations would be needed and the rate that they would need to be fixed.

TTFN,

WK

TTFN,

WK


This message is a reply to:
 Message 98 by eggasai, posted 11-01-2006 10:11 PM eggasai has not yet responded

    
eggasai
Inactive Member


Message 102 of 157 (360652)
11-02-2006 5:48 AM
Reply to: Message 99 by kuresu
11-02-2006 1:03 AM


You think I want you to feel sorry for me, is that it? When I tell you I'm disgusted I mean exactly that. I listened carefully to all the criticisms and often search around seeing what I can find on the net about it. Mostly it's just a pass time and occasionally I have some fun with it. When I talked to sfs on CF before I left the discussion satisfied that I had just misunderstood and let it go at that. Then I happen upon the Time article and it says 98% of chimpanzee and human DNA is the same, I know it's more like 95% and suspect they do as well. Then I find the Chimpanzee Genome webpage Nature puts up and there it is at the top of the Google search for Chimpanzee Genome saying 98% when I know for a fact they read the paper and know that 98% is wrong. I ask sfs about it and he says they just counted the single nucleotide substitutions.

That's great I thought, we'll just pretend that 100,000,000 base pairs are insignifigant. The final straw was telling me the bp in 2x10^-9/bp/generation is not base pair. It can be one or it can be a million when clearly it means one. This isn't a perspective on the evidence or the methodology, this isn't a miscommunication or the inablility of a layman to understand how professional geneticists do their thing. This is flat out wrong.

Nothing in any of the scientific literature suggests that a mutation a million nucleotides/base pairs long is the same as a single one. Now I'm being told that they are just like for years I was told that chimpanzee and human DNA are 99% identical. Now I know for a fact it's no more then 95% simular and probably somewhere between 85% and 90%, who knows?

I don't like being lied to and something else, I wouldn't lie like that to anyone unless I was desperate to hide the truth. Main stream science has been saying for half a century our DNA is 99% chimpanzee and cannot explain how we are not. The latest propaganda is that a bp can be 1 nucleotide/base pair or a million.

Like I told you guys, I'm not intimadated, I'm disgusted.

Edited by eggasai, : No reason given.


This message is a reply to:
 Message 99 by kuresu, posted 11-02-2006 1:03 AM kuresu has not yet responded

Replies to this message:
 Message 113 by RAZD, posted 11-02-2006 7:25 PM eggasai has not yet responded

  
eggasai
Inactive Member


Message 103 of 157 (360667)
11-02-2006 6:43 AM
Reply to: Message 100 by Wounded King
11-02-2006 2:21 AM


Theater of the mind
The debates over dude, I'm just hanging around long enough to tell you guys exactly why. I went through something simular with Liberal theology and finally realized it was just eccumentical atheism. Now in the life sciences you have Darwinian duplicity, the fact is I can't trust anything you guys say. When you are wrong and I know your wrong you won't admit it, why would I ask you about something I am trying to learn? Your just going to tell me wrong.

quote:
Fine then lets do away with semantics and look at some raw data, I'll repost the exercise I suggested earlier.

Sorry buddy, I have suddenly lost all interest. I'm going to put together a blog and maybe start a website where Christians can learn about he historicity of Scripture without having their faith ridiculed. I'm going to use a lot of the HGP stuff to cover the basic life sciences since our tax dollars produced it and they don't mind as long as they get credited.

quote:
No semantics here, just a chance for you to analyse the raw data you

I don't know how many hours I have spent on the thread but if you were going to analyse something you had your chance. When I thought you guys were sincerly trying to get something through to me I was willing to pursue this at any length. Now I think you know the truth and deliberatly distort it.

It's kind of neat though, I started out at Revelations and worked back through the Bible. The final peice of the puzzle was Genesis 1 and 2, now I not only think main stream science is wrong or willfully ignorant, I think their lying through they're teeth.

Happy trails to you,
Mark

Edited by eggasai, : Boombad'eada bombad'eeda


This message is a reply to:
 Message 100 by Wounded King, posted 11-02-2006 2:21 AM Wounded King has responded

Replies to this message:
 Message 104 by Wounded King, posted 11-02-2006 7:09 AM eggasai has responded
 Message 110 by Hyroglyphx, posted 11-02-2006 6:40 PM eggasai has responded

  
Wounded King
Member (Idle past 2169 days)
Posts: 4149
From: Edinburgh, Scotland
Joined: 04-09-2003


Message 104 of 157 (360679)
11-02-2006 7:09 AM
Reply to: Message 103 by eggasai
11-02-2006 6:43 AM


Re: Theater of the mind
I was willing to pursue this at any length.

Except the length of actually looking at any of the relevant basic molecular biology links which would reveal just how twisted your idea of molecular biology is?

Even now you won't look to see if, as I have repeatedly contended, there are regulatory genes which do not operate functionally as proteins. I'm not sure how you can hope to cover the basic life sciences when you have such a tenuous grasp on the fundamentals.

TTFN,

WK


This message is a reply to:
 Message 103 by eggasai, posted 11-02-2006 6:43 AM eggasai has responded

Replies to this message:
 Message 105 by eggasai, posted 11-02-2006 8:19 AM Wounded King has responded

    
eggasai
Inactive Member


Message 105 of 157 (360702)
11-02-2006 8:19 AM
Reply to: Message 104 by Wounded King
11-02-2006 7:09 AM


The truth will prevail, get on the winning side
That's just it, I don't have a tenuous grip of the basics, it never occured to me that RNA programed proteins. I know that bp means base pair and I'm not going to sit here and pretend that you guys didn't want me to think otherwise. I'm not really all that irratated with you guys, it's sfs I'll be taking it up with.

I was enjoying the exchange up until that point, I'm only starting to learn how to navigate Entrenz, I don't need this kind of nonsense leading me down the primrose path. There's just no way I'm going to try to learn something as difficult as molecular biology with people who I know are misleading and lieing to me. The critical spirit, the sharp words, the detail specific analysis I can deal with, that's the best part of it. I won't suffer a liar trying to teach me.

[edited to add]I'll tell you what, I'm done with the thread but you can still impress me with you integrity if you like. Just admit it, bp means base pair and mutations are measured in base pairs or single nucleotides. I don't expect you will even though it is the kind of thing you guys have feeding freenzies about when creationists do it.

Edited by eggasai, : Why would you care why I edited it?

Edited by eggasai, : A little PS stinger before I go.


This message is a reply to:
 Message 104 by Wounded King, posted 11-02-2006 7:09 AM Wounded King has responded

Replies to this message:
 Message 106 by Wounded King, posted 11-02-2006 9:00 AM eggasai has responded
 Message 107 by crashfrog, posted 11-02-2006 9:49 AM eggasai has not yet responded

  
Prev1
...
56
7
891011Next
Newer Topic | Older Topic
Jump to:


Copyright 2001-2018 by EvC Forum, All Rights Reserved

™ Version 4.0 Beta
Innovative software from Qwixotic © 2019