Introduction to Information

quote:

---

If you want to believe that fine, but I didn't say it...you did. Keep that in mind.

---

You said : "(1) I see the definitions I have been using, which are all appropriate for the topic at hand, as being different sides of the same coin (a reduction in uncertainty, in one form or another)."'Different sides of the same coin'. YOU said it, not I.If what you meant was there are a number of definitions for
information that may be of use/relevance to DNA and genomes,
then that's OK. I am currently focussing on the 'reduction
of uncertainty' (as stated in your OP).

quote:

---

Your statement is sloppy and/or loaded.

​

Predictability IS there, just not where you were looking for it.

---

In what way sloppy/loaded?The predictability comes from a statistical analysis of a
number of different, individual genomes of the same species.

quote:

---

And you're wrong.

---

Because ....

quote:

---

Again, sloppy or loaded. Could you please learn to communicate effectively?

---

How so?You seem very evasive in this post.

quote:

---

First, I have not said that there is just one exact definition of information that is applicable to DNA, despite what you imply with your phrase the definition. What I have said is:

​

(1) I see the definitions I have been using, which are all appropriate for the topic at hand, as being different sides of the same coin (a reduction in uncertainty, in one form or another).

---

quote:

---

So you, effectively, have only one definition (otherwise it wuldn't be very definitive), and that is 'reduction in uncertainty'. If all other definitions that you use are 'flip-sides' then you really only have ONE definition.

---

quote:

---

If you want to believe that fine, but I didn't say it...you did. Keep that in mind.

---

quote:

---

You said : "(1) I see the definitions I have been using, which are all appropriate for the topic at hand, as being different sides of the same coin (a reduction in uncertainty, in one form or another)."

​

'Different sides of the same coin'. YOU said it, not I.

---

No, I didn’t say it, you did.You have said BOTH that I am using multiple definitions AND that I am using only one definition. Your statements are self-contradictory.Oh, but you said "effectively" above. Doesn't matter. When I pointed out that whatever multiple definitions I was using were "different sides of the same coin" you rejected it, and continued to claim that they were in fact separate definitions.So if YOU want to believe that I am BOTH using multiple definitions AND ALSO using only one definition - if you want to assert such a self-contradictory position, fine. But remember, it's you doing it, not me.[This message has been edited by DNAunion, 01-09-2004]

quote:

---

So were you saying in the above that the property of predictability is missing, or that I claim it to be missing?

---

quote:

---

Your statement is sloppy and/or loaded.

​

Predictability IS there, just not where you were looking for it.

---

quote:

---

In what way sloppy/loaded?

---

1) I clearly stated where the predictability was — that was the main point of my post. So it is obvious that I was stating that the property of predictability was NOT missing, and went on to explain exactly how and why.So how I be saying choice 1 you offered? I couldn’t. So how could you offer it as a possible position that I was putting forward? You couldn’t, at least not legitimately.2) For option 1 to be in any way legitimate, you’d have to be relying upon misdirecting the reader. Yes, I said predictability was missing WHERE YOU LOOKED FOR IT — which was THE WRONG PLACE. But I clearly said it was there, where you didn't bother to look.So because of the "sloppy/loaded" way your question was phrased, a simple direct answer to it was not easy: that's why I avoided answering your question as phrased, and instead just stated the clear fact, "Predictability IS there, just not where you were looking for it. "

quote:

---

The predictability comes from a statistical analysis of a number of different, individual genomes of the same species.

---

The calculations on ribosome binding sites concerned different genes in the genome, not the same one gene across multiple individuals.[This message has been edited by DNAunion, 01-09-2004]

What I have been saying is that you are SAYING that you
are using only one definition of information ... that
of reduction in uncertainty, and that any other definition
you have used is, in any case, just 'another side' of
the 'same coin'.What you have been DOING is conflating multiple different
definitions of information.The contradiction that you so incitefully noticed is yours.Perhaps you have a different understanding of 'flip side of
the same coin'?

You said that I was looking for predictability in a single
base sequence, and that the property was missing. When I asked
if you were saying that there was no information in a single
base sequence you then said 'No.'My question was niether sloppy, nor loaded. I simply wish to
understand whether you were saying that YOU do not find a
property of predictability in a single base sequence or I
do not.A loaded question is one that is leading in some manner, mine was
not.

quote:

---

The calculations on ribosome binding sites concerned different genes in the genome, not the same one gene across multiple individuals.

---

OK.So the statistical analysis is over binding sites in individual
organisms.

quote:

---

You said that I was looking for predictability in a single base sequence, and that the property was missing. When I asked if you were saying that there was no information in a single base sequence you then said 'No.'

---

Let’s try to keep all the context, okay. Here’s the original exchange.

quote:

---

Peter: So you agree that a single DNA sequence contains no information according to the definition that you consider most approriate?

​

********************************************
DNAunion: Nope.

​

First, I have not said that there is just one exact definition of information that is applicable to DNA, despite what you imply with your phrase the definition. What I have said is:

​

(1) I see the definitions I have been using, which are all appropriate for the topic at hand, as being different sides of the same coin (a reduction in uncertainty, in one form or another).

​

(2) YOUR definition, which requires a conscious agent for there to be information, IS inappropriate when discussing cellular DNA.

​

Point (2) is key. It shows us why your position that DNA does not contain information is, and has been, invalid. (http://EvC Forum: Introduction to Information -->EvC Forum: Introduction to Information)

---

So which part don’t you understand?[This message has been edited by DNAunion, 01-12-2004]

quote:

---

So which part don’t you understand?

---

The part that I asked the question about ... twice ...
and which you have not answered yet.You have said that there is no predictability in a single
base sequence, becuase that's the wrong place to look for
it. When I then asked 'So you agree that there is no
predictability in a single base sequence?' you replied
'Nope.'All I asked was do you see a lack of predictability in a
single base sequence or were you saying that I claimed that
to be the case (and am in error)?That's a straight forward, clarification question. Not loaded,
fairly well specified and unambiguous.As to my 'no information' agrument, I think we agree that if
one takes the 'information' definition which includes
intelligent interpretation then there isn't ... and you feel
that this makes it an inapproriate definition. That would seem
to be because under that definition you would be wrong, rather
than any particular problem with the definition itself.Reduction of uncertainty doesn't exist unless the base sequences
are ordered by an intelligence.You also claim a 'algorithmic' 'data processing' style of
operation of the cell 'controlled' by DNA. This is patently
incorrect. It may be a useful analogy, but the activity in the
cell is chemistry only -- extremely complex sets of interactions
yes, but not 'controlled' in any meaningful sense of the word.

quote:

---

So which part don’t you understand?

---

quote:

---

The part that I asked the question about ... twice ...
and which you have not answered yet.

---

You mean the question I already answered? See my last post.

quote:

---

You have said that there is no predictability in a single
base sequence, becuase that's the wrong place to look for
it. When I then asked 'So you agree that there is no
predictability in a single base sequence?' you replied
'Nope.'

---

Wrong. That is not the question you asked. Look back at my last post, which contains that actual question you asked.

quote:

---

As to my 'no information' agrument, I think we agree that if
one takes the 'information' definition which includes
intelligent interpretation then there isn't ... and you feel
that this makes it an inapproriate definition.

---

Of course the requirement of conscious interpretation makes your definition the wrong one to use when discussing DNA (DNA as it relates molecular cell biology and genetics, of course...not Distributed interNet Architecture). Yours is clearly not the definition biologists use, nor is it the definition chemists use when discussing DNA. They use appropriate definitions.

quote:

---

That would seem to be because under that definition you would be wrong, rather than any particular problem with the definition itself.

---

Nope. See above, and below.Your arguments are...how should I put this...stupid - whatever they are based on, it sure as hell isn't reason and logic. And they never seem to improve.Try asking yourself this.Why do you think all of the biologists and chemists below use a different definition of information than you do when discussing DNA? Do you think THEY don't want me to be wrong? Can they tell the future, and, years ago, knowing that you and I were going to get into this discussion, and, not wanting me to be wrong, they all made false scientific statements for me to use? Is there an anti-Peter conspiracy amongst biologists and chemists, not just now, but in the past too?PLEASE! Use a neuron or two sometime!The following biologists and chemists are making these statements because they are true...not because they don't want me to be wrong.

quote:

---

In Part I of the text we discussed the presence of genes on chromosomes that control phenotypic traits and the way in which the chromosomes are transmitted through gametes to future offspring. Logically, some form of information must be contained in genes, which, when passed to a new generation, influences the form and characteristics of the offspring; this is called the genetic information. (emphasis added, Concepts of Genetics: Fifth Edition, William S Klug & Michael R Cummings, Prentice Hall, 1997, p262)

---

quote:

---

Deoxyribonucleic acid (DNA) is the storehouse, or cellular library, that contains all the information required to build the cells and tissues of an organism. (Molecular Cell Biology: Fourth Edition, Harrvey Lodish, Arnold Beck, S. Lawrence Zipursky, Paul Matsudaira, David Baltimore, & James Darnell, W.H Freeman & Co., 2000, p100)

---

quote:

---

Nucleic acids are complex substances of high molecular weight that represent a basic manifestation of life. The sequence of nitrogenous bases in these polymeric molecules encodes the genetic information necessary for all aspects of biological inheritance. (Integrated Principles of Zoology: Tenth Edition, Cleveland P Hickman Jr., Larry S. Roberts, & Allan Larson, WCB McGraw-Hill, 1996, p7)

---

quote:

---

"Nucleic acids are substituted polymers of the aldopentose ribose that carry an organism's genetic information. A tiny amount of DNA in a fertilized egg cell determines the physical characteristics of the fully developed animal. The difference between a frog and a human being is encoded in a relatively small part of the DNA. Each cell carries a complete set of genetic instructions that determine the type of cell, what its function will be, when it will grow and divide, and how it will synthesize all the proteins, enzymes, carbohydrates, and other substances the cell and the organism need to survive. ... DNA is relatively stable, providing a medium for transmisiion of genetic information from generation to generation." (Organic Chemistry: Fourth Edition, L. G. Wade Jr., Prentice Hall, 1999, p1103)

---

quote:

---

A crucial feature of a nucleic acid molecule is the sequence of the four bases along the strand, called the base sequence. The molecules are huge, with molecular masses ranging into the billions for mammalian DNA, so the four bases may be arranged in an essentially infinite number of variations. The specific sequence of the bases along the chain is the information storage system needed to build organisms. (General Chemistry: An Integrated Approach: Second Edition, John W Hill & Ralph H Petrucci, Prentice Hall, 1999, p984)

---

quote:

---

Now we know that an organism’s inherited instructions reside in the genetic information of each of its cells as DNA, and we can tell a coherent genetic story starting with this molecules.

​

But first let’s step back and use Figure 14-1 to preview how DNA functions as instructional information in cells and, at the same time, how this unit of chapters on information flow in cells is organized. The information carried by DNA flows both between generations of cells and within each individual cell. As Figure 14-1a indicates, the information carried in a eukaryotic cell’s DNA is passed on to daughter cells by the processes of DNA replication and mitosis. Chapter 16 considers the cellular and molecular bases of information flow between generations of sexually reproducing organisms (including Mendel’s work and its chromosomal basis). (The World of the Cell: Third Edition, Wayne M Becker, Jane B Reece, & Martin F Poenie, Benjamin/Cummings Publishing Co., 1996, p408)

---

quote:

---

Every organism, even the simplest, contains a massive amount of information in the form of DNA. The major carriers of genetic information in eukaryotes are the chromosomes contained within the cell nucleus. Chromosomes are made up of chromatin, a complex material that consists of fibers containing protein and deoxyribonucleic acid. Each chromosome may contain hundreds or even thousands of genes. As will be evident in succeeding chapters, our concept of the gene has changed considerably since the beginnings of the science of genetics, but our definitions have always centered on the gene as an informational unit. By providing the information needed to carry out one or more specific cellular functions, a gene ultimately affects some characteristics of the organism. For example, we speak of genes controlling eye color in humans, wing length in fruit flies, seed color in peas, and so on. (Biology: Fifth Edition, Eldra Pearl Solomon, Linda R Berg, & Diana W Martin, Saunders College Publishing, 1999, p198-199)

---

quote:

---

"The sequence of bases in a DNA or RNA molecule is informational, representing the genetic information necessary to reproduce an identical copy of the oragnism." (Biology of Microorganisms: Sixth Edition, Thomas D Brock & Michael T Madigan, Prentice Hall, 1991, p31)

---

quote:

---

Genetics is the science of heredity; it includes the study of what genes are, how they carry information, how they are replicated and passed to subsequent generations of cells or passed between organisms, and how the expression of their information within an organism determines the particular characteristics of that organism. Chromosomes are cellular structures that physically carry hereditary information; the chromosomes contain the genes. Genes are segments of DNA (except in some viruses, in which they are made of RNA) that code for functional products.

​

First, the linear sequence of bases provides the actual information. Genetic information is encoded by the sequence of bases along a strand of DNA, in much the same way as our written language uses a linear sequence of letters to form words and sentences. But 1000 of these four bases, the number contained in an average gene, can be arranged in 4^1000 different ways. This astronomically large number explains how genes can be varied enough to provide all the information a cell needs to grow and perform its functions. (Microbiology: And Introduction: Sixth Edition, Gerard J Tortora, Berdell R Funke, & Christine L Case, Benjamin Cummings, 1998, p207-208)

---

**********************************

quote:

---

For some single-celled organisms whose DNA nucleotide strings have only a fraction of the length of those in our own cells, we can make a crude estimate of the information content. The DNA of an amoeba (a nonsocial one), for example, holds on the order of 10^9 bits. In other words, one billion yes/no instructions are written down in that four-letter script — enough to make another amoeba. This script contains everything an amoeba ever needs to know — how to make its enzymes, how to make its cell membrane, how to slink about, how to digest the foodstuffs, how to react when it gets too dry or too hot, how to reproduce itself. And all of that information is enscrolled into a space so small you would need a good microscope to make it out. If you wanted to give all these instructions in the English language, they would fill some 300 volumes of the size of this book (the information content of an average printed page in English is roughly 10,000 bits). (The Touchstone of Life: Molecular Information, Cell Communication, and the Foundations of Life, Werner R. Loewenstein, Oxford University Press, 1999, p16)

---

quote:

---

[Schrodinger’s] book, titled What is Life?, is a classic — still in print, and well worth seeking out — that expounded the idea that the fundamental molecules of life could be understood in terms of the laws of physics. The important molecules to explain in those terms are the genes that carry information about how the body is to be constructed and how it is to operate.

​

The order in which different chemical components, called bases, are strung along the DNA spines carries information that the living cell uses to construct the protein molecules that do all the work (In Search of Schrodinger’s Cat: Quantum Physics and Reality, John Gribbin, Bantam Books, 1984, p149)

---

quote:

---

All of cellular life is involved in transforming inputs into outputs, the way computers do. Cells are not just little bags of alphabet soup, full of things like ATP and NADH, but are tiny chemical calculators. Compared to even the best of human computers, the living cell is an information processor extraordinaire.

​

This is a programming system that’s been around three billion years, Adelman said. I’ll bet it has a lot to tell us aobut how to program....It’s a dazzling display of information processing ability.

​

... The DNA in a cell contains enough information not only to make a human body, but to operate one for a lifetime. A gram of dried-out DNA — about the size of two pencil erasers — stores as much information as maybe a trillion CD-ROM disks, Adelman points out. So long before Adelman realized that nature had beaten Alan Turing to the idea of a Turing machine, biologists knew that DNA was the master information storage molecule.

​

... Almost from the moment [Watson and Crick] figured out DNA’s design in 1953, it was clear that it stored the information necessary for life to function, reproduce, and evolve. (The Bit and the Pendulum: From Quantum Computing to M Theory — The New Physics of Information, Tom Siegfried, John Wiley & Sons, Inc., 2000, p97)

---

*******************************************

quote:

---

A ribosome is a collection of proteins and RNAs which reads messenger RNA and uses that information to construct proteins. This translation process starts in a region called the ribosome binding site [Gold et al., 1981,Stormo et al., 1982b]. One problem facing ribosomes is to locate the binding sites.
The bacterium Escherichia coli has approximately 2600 genes [Schneider et al., 1986], each of which starts with a ribosome binding site. These have to be located from about 4.7 million bases of RNA which the cell can produce [Kohara et al., 1987]. So the problem is to locate 2600 things from a set of 4.7 x 10^6 possibilities, and not make any mistakes. How many choices must be made?

​

The solution to this question, log2(4.7 x 10^6/2600) bits, is ``obvious'' to those of us versed in information theory, but the reasoning behind how this works in a biological system is subtle and not obvious, so let's consider a simpler example

​

​

How much information do we need to describe the patterns here? To say that position +1 always has a U requires telling you 2 bits of information since that is a selection of one thing (U) from four things (A, C, G, U). If a position has half A and half G, then that is a selection of 2 from 4, or only 1 bit. In the case of the ribosome we again apply the idea of before and after states. Before binding, the ribosome's ``fingers'' see 4 possibilities and don't distinguish amongst them. We say that each finger is ``uncertain'' by log2(4) = 2 bits. After binding, the uncertainty at each finger is lower. If there is 1 base, then the uncertainty is log2(1) = 0 bits. The decrease in uncertainty is a measure of the sequence conservation or information at the binding site. With 1 base this is log2(4) — log2(1) = 2 bits. If a finger accepts 2 bases after then the uncertainty remaining is log2(2) = 1 bit and the information is log2(4) - log2(2) = 1 bit. When a ``finger'' accepts all 4 bases, it really doesn't do anything and the information it demands in sequence conservation is log2(4) — log2(4) = 0 bits. (http://www.lecb.ncifcrf.gov/.../paper/nano2/latex/index.html)

---

quote:

---

"What Is Information?
Information, in its connotation in physics, is a measure of order -- a universal measure applicable to any structure, any system. It quantifies the instructions that are needed to produce a certain organization. ... In general, then, we compute the information inherent in any given arrangement of matter (or energy) from the number of choices we must make to arrive at that particular arrangement among all equally possible ones.

​

This is the equation that Claude Shannon set forth in a theorem in the 1940s, a classic in information theory.

​

Thus defined, information is a universal measure that can be applied equally well to a row of cards, a sequence of amino acids, a score of music, an arrangement of flowers, a cluster of cells, or a configuration of stars.

​

​

For some single-celled organisms whose DNA nucleotide strings have only a fraction of the length of those in our own cells, we can make a crude estimate of the information content. The DNA of an amoeba (a nonsocial one), for example, holds on the order of 10^9 bits. In other words, one billion yes/no instructions are written down in that four-letter script — enough to make another amoeba. This script contains everything an amoeba ever needs to know — how to make its enzymes, how to make its cell membrane, how to slink about, how to digest the foodstuffs, how to react when it gets too dry or too hot, how to reproduce itself. And all of that information is enscrolled into a space so small you would need a good microscope to make it out. If you wanted to give all these instructions in the English language, they would fill some 300 volumes of the size of this book (the information content of an average printed page in English is roughly 10,000 bits). (The Touchstone of Life: Molecular Information, Cell Communication, and the Foundations of Life, Werner R. Loewenstein, Oxford University Press, 1999, p6-7, 8, 16)

---

quote:

---

So far, I have been somewhat cavalier in the use of the term information. Computer scientists draw a distinction between syntax and semantics. Syntactic information is simply raw data, perhaps arranged according to rules of grammar, whereas semantic information has some sort of context or meaning. Information per se doesn’t have to mean anything. Snowflakes contain syntactic information in the specific arrangement of their hexagonal shapes, but these patterns have no semantic content, no meaning for anything beyond the structure itself. By contrast, the distinctive feature of biological information is that it is replete with meaning. DNA stores the instructions needed to build a functioning organism; it is a blueprint or an algorithm for a specified, predetermined product. Snowflakes don’t code for, or symbolize, anything, whereas genes most definitely do. (Paul Davies, The Fifth Miracle: The Search for the Origin and Meaning of Life, Simon & Schuster, 1999, p60)

---

quote:

---

If you always take information to be a decrease in uncertainty at the receiver and you will get straightened out:
R = Hbefore - Hafter.
where H is the Shannon uncertainty:

​

H = - sum (from i = 1 to number of symbols) Pi log2 Pi (bits per symbol)

​

and Pi is the probability of the ith symbol. If you don't understand this, please refer to "Is There a Quick Introduction to Information Theory Somewhere?".

​

Imagine that we are in communication and that we have agreed on an alphabet. Before I send you a bunch of characters, you are uncertain (Hbefore) as to what I'm about to send. After you receive a character, your uncertainty goes down (to Hafter). Hafter is never zero because of noise in the communication system. Your decrease in uncertainty is the information (R) that you gain.

​

​

A way to see this is to work out the information in a bunch of DNA binding sites.

​

Definition of "binding": many proteins stick to certain special spots on DNA to control genes by turning them on or off. The only thing that distinguishes one spot from another spot is the pattern of letters (nucleotide bases) there. How much information is required to define this pattern?

​

Here is an aligned listing of the binding sites for the cI and cro proteins of the bacteriophage (i.e., virus) named lambda:

​

alist 5.66 aligned listing of:
* 96/10/08 19:47:44, 96/10/08 19:31:56, lambda cI/cro sites piece names from:
* 96/10/08 19:47:44, 96/10/08 19:31:56, lambda cI/cro sites
The alignment is by delila instructions
The book is from: -101 to 100
This alist list is from: -15 to 15

​

[unfortunately, this ‘table’ doesn’t carry over well — it’s alignment is lost: see the linked-to page]

​

------ ++++++
111111--------- +++++++++111111
5432109876543210123456789012345
...............................
OL1 J02459 35599 + 1 tgctcagtatcaccgccagtggtatttatgt
J02459 35599 - 2 acataaataccactggcggtgatactgagca
OL2 J02459 35623 + 3 tttatgtcaacaccgccagagataatttatc
J02459 35623 - 4 gataaattatctctggcggtgttgacataaa
OL3 J02459 35643 + 5 gataatttatcaccgcagatggttatctgta
J02459 35643 - 6 tacagataaccatctgcggtgataaattatc
OR3 J02459 37959 + 7 ttaaatctatcaccgcaagggataaatatct
J02459 37959 - 8 agatatttatcccttgcggtgatagatttaa
OR2 J02459 37982 + 9 aaatatctaacaccgtgcgtgttgactattt
J02459 37982 - 10 aaatagtcaacacgcacggtgttagatattt
OR1 J02459 38006 + 11 actattttacctctggcggtgataatggttg
J02459 38006 - 12 caaccattatcaccgccagaggtaaaatagt
^

​

Each horizontal line represents a DNA sequence, starting with the 5' end on the left, and proceeding to the 3' end on the right. The first sequence begins with: 5' tgctcag ... and ends with ... tttatgt 3'. Each of these twelve sequences is recognized by the lambda repressor protein (called cI) and also by the lambda cro protein.

​

What makes these sequences special so that these proteins like to stick to them? Clearly there must be a pattern of some kind.

​

Read the numbers on the top vertically. This is called a "numbar". Notice that position +7 always has a T (marked with the ^). That is, according to this rather limited data set, one or both of the proteins that bind here always require a T at that spot. Since the frequency of T is 1 and the frequencies of other bases there are 0, H(+7) = 0 bits. But that makes no sense whatsoever! This is a position where the protein requires information to be there.

​

That is, what is really happening is that the protein has two states. In the BEFORE state, it is somewhere on the DNA, and is able to probe all 4 possible bases. Thus the uncertainty before binding is Hbefore = log2(4) = 2 bits. In the AFTER state, the protein has bound and the uncertainty is lower: Hafter(+7) = 0 bits. The information content, or sequence conservation, of the position is Rsequence(+7) = Hbefore - Hafter = 2 bits. That is a sensible answer. Notice that this gives Rsequence close to zero outside the sites.
(http://www.faqs.org/faqs/biology/info-theory/)

---

quote:

---

DNA transposable elements include simple insertion sequences, transposons and some bacteriophages in eubacteria, and similar elements in archeobacteria and eukaryotes. They have the potential to remodel genomes and to facilitate the lateral transmission of genetic information such as antibiotic resistance determinants. (Three-Dimensional Structure of the Tn5 Synaptic Complex Transposition Intermediate, Douglas R. Davies, et. al., Science vol 289, No. 5476, (7 July 2000), p77)

---

quote:

---

The absence of an enslaved nucleophile (the 2’-hydroxyl group) at each phosphodiester linkage makes DNA ~100,000-fold more stable than RNA under physiological conditions. Similarly, DNA phosphodiester bonds are 100-fold more resistant to hydrolytic degradation than the peptide bonds of proteins. This stability, coupled with the complementary character of nucleotides, makes DNA an ideal molecule for information storage and transfer.

​

Deoxyribozymes have been created that cleave DNA by an oxidative mechanism or by depurination. These deoxyribozymes eliminate a nucleotide from the target DNA chain, and therefore might be valuable in applications where the loss of sequence-encoded information is tolerated or perhaps even desirable. (Making Catalytic DNA, Ronald R Breaker, Science, Vol 290, No. 5499, (15 Dec 2000), p2095, 2096)

---

quote:

---

"These genetic elements "jump" from old to new DNA locations, a process that mutates genes, rearranges chromosomes, and transmits genetic information between cells." (Transposase Team Puts a Headlock on DNA, Tanya L. Williams and Tania A. Baker, Science Vol. 289,No. 5476, (July 7 2000), p73)

---

quote:

---

"The information is in the primary DNA sequence, as Watson and Crick told us," Rosenfeld says." (New Clues to How Genes are Controlled, Jean Marx, Science, Vol. 290, No. 5494, (10 Nov 2000), p1067)

---

quote:

---

Basic Concepts of Genetics

​

​

What is the center of heredity in a cell?
Eukaryotic organisms are characterized by the presence of a nucleus that contains the genetic material [i.e., DNA]. In prokaryotes, such as bacteria, the genetic material [i.e., DNA] exists in an unenclosed but recognizable area of the cell called the nucleoid region.

​

What is the genetic material?
In eukaryotes and prokaryotes, DNA serves as the molecule storing genetic information.

​

How is DNA organized to serve as the genetic material?
DNA, although single stranded in a few viruses, is usually a double-stranded molecule organized as a double helix. Contained within each DNA molecule are hereditary units called genes, which are part of a larger element, the chromosome.

​

What is a gene?
In simplest terms, the gene is the functional unit of heredity. In chemical terms, it is a linear array of nucleotides — the chemical building blocks of DNA and RNA.

​

​

What are the sources of genetic variation?
Classically, there are two sources of genetic variation: chromosomal mutations and gene mutations. Gene mutations result from a change in the chemical information stored in DNA, collectively referred to as an organism’s genotype. Such a change may include substitution, duplication, or deletion of nucleotides, which compose this chemical information. Alternative forms of a gene, which result from mutation, are called alleles.

​

How does DNA store genetic information?
The sequence of nucleotides in a segment of DNA constituting a gene is present in the form of a genetic code. This code specifies the chemical nature (the amino acid composition) of proteins, which are the end product of genetic expression. Mutations are produced when the sequence of nucleotides is altered.

​

How is the genetic code organized?
There are four different nucleotides in DNA, each varying in one of its components, the nitrogenous base. The genetic code is a triplet; therefore, each combination of three nucleotides constitutes a code word. Almost all possible triplet codes specify one of 20 amino acids, the chemical building blocks of proteins.

​

How is the genetic code expressed?
The coded information in DNA is first transferred during a process called transcription into a messenger RNA (mRNA) molecule. The mRNA subsequently associates with the cellular organelle, the ribosome, where it is translated into a protein molecule.

​

Are there exceptions where proteins are not the end product of a gene?
Yes. For example, genes coding for ribosomal RNA (rRNA), which is part of the ribosome, and for transfer RNA (tRNA), which is involved in the translation process, are transcribed but not translated. Therefore, RNA is sometimes the end product of stored genetic information.
(Concepts of Genetics: Fifth Edition, William S Klug & Michael R Cummings, Prentice Hall, 1994, p6-8)

---

Obviously there is a definition of information other than yours...any moron could see that. And obviously, the definition the above authors use - which sure as hell isn't yours - is APPROPRIATE when discussing DNA...it's an unavoidable conclusion. Only a complete and utter imbicile could conclude otherwise. And surely these scientists are not worried in the least about me being wrong in a debate against you.So, in case you you STILL don't get it....NO, I am not using a differnt definition of information than you just to avoid being wrong. Unlike you, I am using definitions that are APPROPRIATE for the topic of discussion.Is there nothing anyone can tell you that will drive that message home? Or is the barrier that separates your brain from the real world just too damned thick?[This message has been edited by DNAunion, 01-13-2004]

quote:

---

Peter: So you agree that a single DNA sequence contains no information according to the definition that you consider most approriate?

​

'So you agree that there is no predictability in a single base sequence?'

---

Look at the two questions ... hmmm ... or are they two questions?The 'definition' under discussion was 'information == reduction in
uncertainty' and reduction of uncertainty implies increased
predictability.No information and no predictability are exactly equivalent under
the reduction of uncertainty definition for information.The questions where the same, you haven't answered (clearly).What your answers appear to say is that you agree that there
is no predictability, and thus no information in a single
DNA sequence. BUT when asked if you agreed this to be the
case you said 'Nope.'I think a clarification is in order, rather than re-stating
that you have already answered.Perhaps I am just dense and need your response in simpler
format.

The entire lenghty post to which this is a response
is, how could I put this delicately ... er ...
evasive.I have already said that the definition for information
which includes 'consciouness' or some variant is not relevant
to DNA sequences. I say 'DNA has no information under this
definition' you say 'The definition is not approriate for
discussing DNA' so we agree. Stop harping on about MY
definition of information -- it's actually a soft systems
definition gleaned from literature survey.You appeal to authority a lot, do you read critically?Have you gone through those quotations and considered what each
set of authors means by information?E.g.

quote:

---

In Part I of the text we discussed the presence of genes on chromosomes that control phenotypic traits and the way in which the chromosomes are transmitted through gametes to future offspring. Logically, some form of information must be contained in genes, which, when passed to a new generation, influences the form and characteristics of the offspring; this is called the genetic information. (emphasis added, Concepts of Genetics: Fifth Edition, William S Klug & Michael R Cummings, Prentice Hall, 1997, p262)

---

When this author says 'Logically,...' do you think that this
means 'Logically' or 'I have assumed'?i.e. is it used literally/formally or literatively?Bear in mind that text books do not undergo peer review, and
there is no motivation to be overly formal in language usage.Similarly many of the quotations where information is used,
it is used informally in an every-day manner. I have no objection
to using an analogy to information beyind the unessacary confusion
it generates (amongst particularly, but not limited to, creationists).I have considered the definition you put forward in the OP,
that if reduction of uncertainty, wrt DNA sequences and cannot
see how there is any reduction in uncertainty.If one rearranges things and performs a statistical analysis
one can see that some parts do basically the same thing as
one another even though there is variance over the base sequence.The concept of information in biology is used to MODEL
DNA ... that doesn't mean there is any information content
of DNA.

quote:

---

Peter: So you agree that a single DNA sequence contains no information according to the definition that you consider most approriate?

​

'So you agree that there is no predictability in a single base sequence?'

​

Look at the two questions ... hmmm ... or are they two questions?

​

The 'definition' under discussion was 'information == reduction in
uncertainty' and reduction of uncertainty implies increased
predictability.

---

No, it doesn't.Take the example of determining what card a person drew, starting from maximum uncertainty (1 ouf ot any 52). At that point, you can't predict what card was drawn (you can give a complete, uninformed guess, but that's not predicting). Finding out that the card is black reduces your uncertainty by 1/2: now it is any one out of 26 cards. You've received one bit of information. Can you now predict the particular card that was chosen? No. Of the remaining possibilities, you have complete uncertainty (again, you could take a complete stab in the dark, but that would be just guessing, not predicting). So, you couldn't predict before you received the information, and you couldn't predict after you received the information, but you sure as hell did receive information.

quote:

---

The questions where the same, you haven't answered (clearly).

---

No, the questions are not the same. See above.[This message has been edited by DNAunion, 01-14-2004]

quote:

---

Take the example of determining what card a person drew, starting from maximum uncertainty (1 ouf ot any 52). At that point, you can't predict what card was drawn (you can give a complete, uninformed guess, but that's not predicting). Finding out that the card is black reduces your uncertainty by 1/2: now it is any one out of 26 cards. You've received one bit of information. Can you now predict the particular card that was chosen? No. Of the remaining possibilities, you have complete uncertainty (again, you could take a complete stab in the dark, but that would be just guessing, not predicting). So, you couldn't predict before you received the information, and you couldn't predict after you received the information, but you sure as hell did receive information.

---

So there is no reduction of uncertainty in your primary example
of what information is. But then you've just changed the scenario
by including the 'of the remaining cards'.A prediction, in any case, is an informed choice based upon
currently observed data (surely). Reducing ones uncertainty
of the outcome is equivalent to increasing the predictability
of the outcome.If you don't accept predicatbility and uncertainty as related
stop using Shannon-Weaver information concepts -- because they
DO view them as interconnected concepts. I assume you HAVE read
and understood Shannon's 1948 paper.What does a DNA sequence reduce the uncertainty of?PS: Whether predictability and reduction of uncertainty are
equivalent or not -- you have still refused to answer a simple,
direct question. One must wonder why that is?Your probably answer will be a rant about the last part of my
post, and still neglect a simple direct answer to the question
regarding your apparent ambivalence.[This message has been edited by Peter, 01-16-2004]

quote:

---

So there is no reduction of uncertainty in your primary example of what information is.

---

Of course there is a reduction in uncertainty in the primary example I gave of what information is. Even my CHILDREN who I explained it to understood that, and they’re only 8 and 9. Gee, I guess they’re just smarter than you are.

quote:

---

But then you've just changed the scenario by including the 'of the remaining cards'.

---

YOU brought up predictability, which was NOT part of my primary example of information. To explain the lack of predictability while there still being information gained, which was NOT part of my primary example of information, I presented it but with a slight modification. That form addressed your stupid position, which was easily countered.In fact, the ORIGINGAL form would work too: that modification is not important, despite your trying to make it sound like everything crumbles because of it.Even sticking to the original set of 52 cards, you still can't make a prediction, other than the totally stupid 'prediction', "uhh, duhh, well, gee, I predict it's not one of the cards that have already been eliminated". Well no fricking duh. Stating what you already know is not a prediction.

quote:

---

If you don't accept predicatbility and uncertainty as related stop using Shannon-Weaver information concepts -- because they DO view them as interconnected concepts.

---

Look you fricking retard, YOU are the one who asserted I use ONLY ONE definition of information...remember?Remember how I made it a point that YOU SAID IT, NOT ME?Remember how I said I use reduction in uncertainty, IN ONE FORM OR ANOTHER?You got that much you fricking retard?Now, go back to the original version of my primary example of information - dealing with cards - and explain to us exactly how that definition I am using there - based on reduction in uncertainty - doesn't work. You can't...it works. Now, do you see me mentioning anything about predictability? Nope. So is predictability part of that definition of information I used? Nope. So am I claiming to always use Shannon's definition of information? NO, you fricking moron.In fact, I have even stated several times, something like "or in the stricter Shannon sense of information". So, am I claiming to always use Shannon's definition of information? NO, you fricking moron.

quote:

---

I assume you HAVE read and understood Shannon's 1948 paper.

​

What does a DNA sequence reduce the uncertainty of?

---

I assume you have NOT read or understood any of the T Schneider papers.I told you this several weeks ago: IF YOU HAVE A PROBLEM WITH SCIENTISTS FINDING INFORMATION IN DNA USING SHANNON'S INFORMATION THEORY, TAKE IT UP WITH T. SCHNEIDER: IT IS HE, AFTER ALL, WITH WHOM YOU DISAGREE. Are you chicken?

quote:

---

PS: Whether predictability and reduction of uncertainty are equivalent or not -- you have still refused to answer a simple, direct question. One must wonder why that is?

---

One would wonder why anyone - well, anyone other than a fricking retard of course - would not post the one question he claims the other person hasn’t answered.Furthermore, YOU, you fricking retarded monkey, are the one who couldn't see that you actually asked TWO DIFFERENT questions: even after I pointed it out to you more than once.[This message has been edited by DNAunion, 01-17-2004]

quote:

---

What I have been saying is that you are SAYING that you are using only one definition of information ...

---

So now you’re resorting to lying? Look, you fricking moron, I have NOT said that I am using only one definition. YOU say that, NOT ME.Look, your fricking retarded monkey, at these statements of mine from our exchanges on this.

quote:

---

PETER [the fricking retard]: So you agree that a single DNA sequence contains no information according to the definition that you consider most approriate?

​

****************************

​

DNAunion [the person frustrated with trying to debate a fricking retarded monkey]: Nope.

​

First, I have not said that there is just one exact definition of information that is applicable to DNA, despite what you imply with your phrase the definition. What I have said is:

​

(1) I see the definitions [see the 's' there Peter? Can you read, you fricking moron?] I have been using, which are all appropriate for the topic at hand, as being different sides of the same coin (a reduction in uncertainty, in one form or another). (http://EvC Forum: Introduction to Information -->EvC Forum: Introduction to Information)

---

quote:

---

So, in case you you STILL don't get it....NO, I am not using a differnt definition of information than you just to avoid being wrong. Unlike you, I am using definitions [see the "s" Peter? Can you read, you fricking moron?] that are APPROPRIATE for the topic of discussion. (http://EvC Forum: Introduction to Information -->EvC Forum: Introduction to Information)

---

Can you read, you fricking retarded monkey? Are you too damned stupid to understand that an "s" on the end of the word DEFINTION makes it plural? Seriously, I am asking, because you show all the signs of being too fricking stupid to tie your own shoes.

quote:

---

that of reduction in uncertainty, and that any other definition you have used is, in any case, just 'another side' of the 'same coin'.

​

What you have been DOING is conflating multiple different definitions of information.

---

I have used multiple definitions that are different sides of the same coin. The coin, which is common to all, is reduction in uncertainty. I have not claimed that definitions related to that "coin" are all the same: just one single definition. If YOU want to claim that, feel free but it will be YOU saying so, NOT ME.

quote:

---

The contradiction that you so incitefully noticed is yours.

---

No, jackass, it’s all you. YOU claim I am using ONLY ONE definition, AND YOU claim I am using multiple definitions. That’s YOU doing the self-contradicting, NOT ME.

quote:

---

Perhaps you have a different understanding of 'flip side of the same coin'?

---

No, perhaps YOU do.But the point is probably irrelevant anyway since your above argument was based on a lie.[This message has been edited by DNAunion, 01-17-2004]