Understanding through Discussion


Welcome! You are not logged in. [ Login ]
EvC Forum active members: 78 (8960 total)
117 online now:
Faith, frako (2 members, 115 visitors)
Newest Member: Mikee
Post Volume: Total: 869,837 Year: 1,585/23,288 Month: 1,585/1,851 Week: 225/484 Day: 1/42 Hour: 1/0


Thread  Details

Email This Thread
Newer Topic | Older Topic
  
Author Topic:   Problems with evolution? Submit your questions.
Taq
Member
Posts: 8218
Joined: 03-06-2009
Member Rating: 3.4


(1)
Message 57 of 752 (566242)
06-23-2010 4:49 PM
Reply to: Message 51 by ICANT
06-23-2010 3:40 PM


Re: Question
How does the mutation or natural selection produce new information?

Would you agree that the human genome and the chimp genome contain different information? Is this difference in information due to the difference in DNA sequence? If you answered yes to both then you must also agree that a change in DNA sequence due to a mutation is new information. If you answered no to either question then please explain.

Do you have an empirical example of a code or language that occurs naturally?

The orbitals of atoms is a good example. Hydrogen, the simplest element, has the code 1s^1. Helium is 1s^2. Read more here. Everything made up of atoms or particles has a code.


This message is a reply to:
 Message 51 by ICANT, posted 06-23-2010 3:40 PM ICANT has not yet responded

Taq
Member
Posts: 8218
Joined: 03-06-2009
Member Rating: 3.4


(1)
Message 73 of 752 (567187)
06-30-2010 12:23 AM
Reply to: Message 70 by Peg
06-29-2010 9:01 PM


so the seed came first and it grew from a plant which grew from a spore!

That makes no sense at all. If the seed grows from a plant, then the plant came first

then again, the plant came from a spore so the spore came first....hence a spore produced a plant which produced seed.

So that takes us to the spore..... how did the spore evolve and from what?

Thousands of years ago no one spoke french. Now there are millions of people who speak french. How could this happen? Who did the first french speaker talk to?

Edited by Taq, : No reason given.


This message is a reply to:
 Message 70 by Peg, posted 06-29-2010 9:01 PM Peg has not yet responded

Taq
Member
Posts: 8218
Joined: 03-06-2009
Member Rating: 3.4


Message 268 of 752 (578786)
09-02-2010 3:47 PM


Since we have someone touting their information detection skills, I was wondering if one of you could answer this question.

Which one of the following DNA sequences carries the most information, and why:

1) AATCGGTTATTAAACCGAAA

2) TTGAATACGGTATTGATTTTT

Once you pick out the DNA sequence with the most information of the two, please show me what the sequence looks like once information has either been added or taken away from that sequence, and how you determined the loss and the gain in information.

Thank you.


Replies to this message:
 Message 269 by Blue Jay, posted 09-02-2010 3:54 PM Taq has responded

Taq
Member
Posts: 8218
Joined: 03-06-2009
Member Rating: 3.4


Message 270 of 752 (578789)
09-02-2010 4:09 PM
Reply to: Message 269 by Blue Jay
09-02-2010 3:54 PM


Hi, Taq.
It's a trick question: since neither contains a stop codon, both of them have infinite information content.

Functional open reading frames only comprise 3% or so of the human genome, yet IDer's claim that the entire genome contains information.


This message is a reply to:
 Message 269 by Blue Jay, posted 09-02-2010 3:54 PM Blue Jay has not yet responded

Taq
Member
Posts: 8218
Joined: 03-06-2009
Member Rating: 3.4


Message 365 of 752 (580491)
09-09-2010 12:02 PM
Reply to: Message 363 by Nij
09-09-2010 8:06 AM


Re: What's the problem?
The evolution of a new beta-galactosidase in E. coli

http://www.ncbi.nlm.nih.gov/pubmed/12868605

8 left


This message is a reply to:
 Message 363 by Nij, posted 09-09-2010 8:06 AM Nij has not yet responded

Replies to this message:
 Message 373 by Huntard, posted 09-13-2010 8:39 AM Taq has not yet responded

Taq
Member
Posts: 8218
Joined: 03-06-2009
Member Rating: 3.4


Message 520 of 752 (598968)
01-04-2011 2:11 PM
Reply to: Message 518 by shadow71
01-04-2011 1:55 PM


There are just some things science will not be able to solve. The intricate initial cells to what we have today, I accept came from some form of evolution. However I do not see how science can find the beginning of a naturally cause life.

Evolution is not meant to answer questions as to the origin of life, only the origin of biodiversity. This would be a problem for Abiogenesis, not Evolution (per the title of the thread).

Furthermore, the answer to the question of how the translation system came about may very well be answered by research into the RNA World hypothesis. Proteins are produced by RNA (ribosomal RNA) from RNA (mRNA) using RNA (tRNA). Therefore, RNA can be both a genetic molecule and an enzyme.

But one at some point must logically look at all the circumstantial evidence and form an opinion. My opinion and belief is that God created life.

So what is the positive evidence that you used to conclude that God made the first life?


This message is a reply to:
 Message 518 by shadow71, posted 01-04-2011 1:55 PM shadow71 has not yet responded

Taq
Member
Posts: 8218
Joined: 03-06-2009
Member Rating: 3.4


Message 526 of 752 (599031)
01-04-2011 6:16 PM
Reply to: Message 523 by shadow71
01-04-2011 2:43 PM


There are some things that do not have natural models.

How does a lack of a known natural mechanism indicate that the supernatural was responsible?


This message is a reply to:
 Message 523 by shadow71, posted 01-04-2011 2:43 PM shadow71 has responded

Replies to this message:
 Message 527 by shadow71, posted 01-04-2011 7:04 PM Taq has responded

Taq
Member
Posts: 8218
Joined: 03-06-2009
Member Rating: 3.4


Message 542 of 752 (599207)
01-05-2011 3:39 PM
Reply to: Message 527 by shadow71
01-04-2011 7:04 PM


Well if there is no natural mechanism and something exists, can one not consider a supernatural?

How do you determine if there is no natural mechanism? We would have to have complete knowledge of nature to determine this, wouldn't we? Last I checked, we do not have this level of knowledge yet.

I see on this board a resistance to think about philsophy or any other discplines other than natural science. There are other ways to solve problems and reach conclusions besides science.

Our resistance is to bad philosophy, such as the God-of-the-Gaps philosophy that you are pushing. You seem to think that the best place to find God is in our ignorance. That doesn't seem very inspiring to me.

As to "other ways to solve a problem", when has a supernatural explanation ever turned out to be right? It would seem to me that science has found non-supernatural explanations for thousands of things that used to be credited to the supernatural. Why shouldn't we expect this trend to continue?


This message is a reply to:
 Message 527 by shadow71, posted 01-04-2011 7:04 PM shadow71 has responded

Replies to this message:
 Message 545 by shadow71, posted 01-06-2011 7:56 PM Taq has responded

Taq
Member
Posts: 8218
Joined: 03-06-2009
Member Rating: 3.4


Message 543 of 752 (599208)
01-05-2011 3:42 PM
Reply to: Message 534 by shadow71
01-04-2011 7:29 PM


The problem is you belileve science is the answer to everything.

We know that science has found millions of answers that once alluded us (or were once credited to supernatural magic). It is science's track record that convinces us that it is worth using. Compare that to the abject failure of the thousands of years of supernaturalism in explaining nature prior to the advent of the modern scientific method.


This message is a reply to:
 Message 534 by shadow71, posted 01-04-2011 7:29 PM shadow71 has not yet responded

Taq
Member
Posts: 8218
Joined: 03-06-2009
Member Rating: 3.4


Message 555 of 752 (599434)
01-07-2011 12:50 PM
Reply to: Message 545 by shadow71
01-06-2011 7:56 PM


All four decided that the paper met the journal's editorial standards, Dr. Judd added, even though 'THERE WAS NO MECHANISM BY WHICH WE COULD UNDERSTAND THE RESULTS.'

The difference here is that the authors were able to make predictions of experimental results based on their hypothesis, even if they are lacking a specific mechanism. IOW, they were able to test their hypothesis which is an important step in the scientific method.

There is no testing of hypotheses in creationism. Creationism is a belief that is not challenged. Creationism is a dogmatic religious belief, not a scientifically testable hypothesis.

If the authors of the aforementioned paper were to copy the creationist method then they would cite the lack of a known mechanism as evidence that Leprechauns travel back in time and then whisper the secrets of the future in the subject's ear.

I'll stand on my conclusion that God created the universe and all we know is a scientific conclusion.

Dogmatic religious beliefs are not scientific conclusions.


This message is a reply to:
 Message 545 by shadow71, posted 01-06-2011 7:56 PM shadow71 has acknowledged this reply

Taq
Member
Posts: 8218
Joined: 03-06-2009
Member Rating: 3.4


Message 590 of 752 (606981)
03-01-2011 10:52 AM
Reply to: Message 584 by havoc
03-01-2011 10:39 AM


Re: Cows
Classifications are a human creation and they really tell us nothing about facts.

Linnaean taxonomy is certain a human creation that can be arbitrary at times. Where to draw the line between genera and family is certainly an arbitrary decision. However, the nested hierarchy is a fact, a fact that evolution predicts we should see. ID/creationism does not make this prediction.

The theory of evolution predicts which mixtures of characteristics we should and should not see in both living and fossil species. This is how you test the theory. We should see species with a mixture of reptilian and mammalian features, but we should NOT see a mixture of avian and mammalian features. Therefore, an animal that has mammary glands and lays leathery eggs like the platypus is consistent with evolution while a bird with mammary glands and three middle ear bones would not.

A majory violation of the nested hierarchy would be obvious to everyone, and it would be allowable for ID/creationism. So why don't we see any?


This message is a reply to:
 Message 584 by havoc, posted 03-01-2011 10:39 AM havoc has responded

Replies to this message:
 Message 595 by havoc, posted 03-01-2011 11:16 AM Taq has responded

Taq
Member
Posts: 8218
Joined: 03-06-2009
Member Rating: 3.4


Message 591 of 752 (606982)
03-01-2011 10:53 AM
Reply to: Message 588 by havoc
03-01-2011 10:51 AM


Re: Cows
I have my faith you have yours.

Projection is not an argument. We have the evidence.


This message is a reply to:
 Message 588 by havoc, posted 03-01-2011 10:51 AM havoc has not yet responded

Taq
Member
Posts: 8218
Joined: 03-06-2009
Member Rating: 3.4


Message 592 of 752 (606984)
03-01-2011 10:57 AM
Reply to: Message 578 by havoc
03-01-2011 10:29 AM


Re: Cows
Darwin said a feature that could not exisit through a series of small changes. Behe coined "ireducible complexity" to falsify under these terms.

Behe never demonstrated that IC systems could not evolve. In fact, IC systems were predicted to be a product of evolution in 1918:

quote:
. . . thus a complicated machine was gradually built up whose effective working was dependent upon the interlocking action of very numerous different elementary parts or factors, and many of the characters and factors which, when new, were originally merely an asset finally became necessary because other necessary characters and factors had subsequently become changed so as to be dependent on the former. It must result, in consequence, that a dropping out of, or even a slight change in any one of these parts is very likely to disturb fatally the whole machinery; for this reason we should expect very many, if not most, mutations to result in lethal factors ..."
Muller 1918 pp. 463-464.
Muller, H. J. (1918) "Genetic variability, twin hybrids and constant hybrids, in a case of balanced lethal factors." Genetics 3:422-499.

This message is a reply to:
 Message 578 by havoc, posted 03-01-2011 10:29 AM havoc has responded

Replies to this message:
 Message 597 by havoc, posted 03-01-2011 11:23 AM Taq has responded

Taq
Member
Posts: 8218
Joined: 03-06-2009
Member Rating: 3.4


(1)
Message 593 of 752 (606985)
03-01-2011 11:04 AM
Reply to: Message 567 by havoc
03-01-2011 8:59 AM


Re: Cows
How many generations does it take for a cow to change into something else?

It will never happen. You don't evolve out of your ancestry. In the tree of life you are always a part of the branch you came from. You never clip yourself off from a branch and attach somewhere else. What can happen is that the biodiversity of cows can increase, and perhaps even new species of cow will evolve. Think of all the dog breeds that have emerged from their wolf ancestors and how the wolf is still a dog as are all of the dog breeds.

Edited by Taq, : No reason given.


This message is a reply to:
 Message 567 by havoc, posted 03-01-2011 8:59 AM havoc has responded

Replies to this message:
 Message 599 by havoc, posted 03-01-2011 11:28 AM Taq has responded

Taq
Member
Posts: 8218
Joined: 03-06-2009
Member Rating: 3.4


Message 603 of 752 (606997)
03-01-2011 11:43 AM
Reply to: Message 595 by havoc
03-01-2011 11:16 AM


Re: Cows
Major being the most important word here. We dont find mermaids or pegasus and this is somehow evidence for evolution.

Funny how that works. A theory makes predictions and then those predictions turn out to be true. Usually, people consider this to be validation of the theory, at least those who do not have a religious beef against the theory.

When examples are found it is chalked up to the catch all of convergance.

Examples?

Man made things can also be "nested" Does not prove they evolved.

Actually, no they can't. This is one of the hallmarks of design, the lack of a nested hierarchy. Designers are free to mix and match different design units as they see fit. In fact, humans have designed organisms that clearly violate the nested hierarchy.


This message is a reply to:
 Message 595 by havoc, posted 03-01-2011 11:16 AM havoc has not yet responded

Newer Topic | Older Topic
Jump to:


Copyright 2001-2018 by EvC Forum, All Rights Reserved

™ Version 4.0 Beta
Innovative software from Qwixotic © 2020