Register | Sign In


Understanding through Discussion


EvC Forum active members: 64 (9164 total)
6 online now:
Newest Member: ChatGPT
Post Volume: Total: 916,901 Year: 4,158/9,624 Month: 1,029/974 Week: 356/286 Day: 12/65 Hour: 0/0


Thread  Details

Email This Thread
Newer Topic | Older Topic
  
Author Topic:   Problems with evolution? Submit your questions.
New Cat's Eye
Inactive Member


Message 736 of 752 (607430)
03-03-2011 4:55 PM
Reply to: Message 735 by havoc
03-03-2011 4:52 PM


However an earth quake at the scrabble store will never write a novel.
And because it has no selective pressure it is not analogous to the Theory of Evolution.
This has been pointed out to you already.

This message is a reply to:
 Message 735 by havoc, posted 03-03-2011 4:52 PM havoc has not replied

havoc
Member (Idle past 4783 days)
Posts: 89
Joined: 03-01-2011


Message 737 of 752 (607431)
03-03-2011 4:56 PM
Reply to: Message 732 by Dr Adequate
03-03-2011 4:42 PM


Re: et all
But more obscure yet is the relevance of all this to the question of design detection in DNA. How is my ability to recognize English useful in recognizing whether a certain DNA sequence was produced by design or evolution?
Code is code my friend. Can you name one code that has no code maker?

This message is a reply to:
 Message 732 by Dr Adequate, posted 03-03-2011 4:42 PM Dr Adequate has replied

Replies to this message:
 Message 740 by New Cat's Eye, posted 03-03-2011 5:02 PM havoc has not replied
 Message 743 by Dr Adequate, posted 03-03-2011 5:23 PM havoc has not replied
 Message 746 by Taq, posted 03-03-2011 5:35 PM havoc has not replied

Granny Magda
Member
Posts: 2462
From: UK
Joined: 11-12-2007
Member Rating: 3.8


Message 738 of 752 (607432)
03-03-2011 4:57 PM
Reply to: Message 719 by havoc
03-03-2011 3:47 PM


Re: my karma ran over your frogma
No I was just pointing out an evolutionists insistance on homology as evidence for evolution was not warranted
Or to put it another way, your original point about frogs and AERs was total bullshit, so now you are trying to change the subject and act defiant, instead of admitting that you were 100% wrong.
Fine.
The ToE does not predict that every single feature must entirely homologous to features in every other member of a group. That would just be ridiculous. Evolution predicts that some species will have novel features and that is exactly what we observe in the case of this tree frog.
Only a creationist could point to a case of a species displaying a novel morphological feature and call it evidence against evolution.
Even Gavin Debeer said:
Whatever de Beer said, it is clear that he did not consider it evidence against evolution, nor does he argue here against the concept of homology, so your point remains obscure.
Also; de Beer died nearly forty years ago. Nice up to date source on your genetics info there champ! You might like to try something a bit more recent. Genetics has moved on quite a bit since then you know. But I guess that just cutting and pasting from creo websites, as you did here, is a little less taxing on your little grey cells.
You have to believe that the fleetingly unlikely event of just the right mutations led to for example 5 digits on vertebrate for limbs but then the mechanism was lost and regained in an entirely different way several times.
You have not demonstrated that any such thing happened though. All you did was repeat Jonathon Sarfati's mendacious and moronic drivel about frogs.
Did I mention that you were wrong about that and that Sarfati is an idiot?
Mutate and Survive

On two occasions I have been asked, — "Pray, Mr. Babbage, if you put into the machine wrong figures, will the right answers come out?" ... I am not able rightly to apprehend the kind of confusion of ideas that could provoke such a question. - Charles Babbage

This message is a reply to:
 Message 719 by havoc, posted 03-03-2011 3:47 PM havoc has not replied

Percy
Member
Posts: 22504
From: New Hampshire
Joined: 12-23-2000
Member Rating: 4.9


Message 739 of 752 (607433)
03-03-2011 5:02 PM
Reply to: Message 734 by havoc
03-03-2011 4:49 PM


Re: et all
havoc writes:
Perdition writes:
The thing is, in DNA, there really is no such thing as random keystrokes
Realy so mutation is no longer random? Answer carefully your entire world view hangs in the balance.
You only quoted a small portion of what Perdition said, plus you seem to have forgotten the context. One of your questions was how we would tell the difference between English and gibberish, and the paragraph containing the sentence you misleadingly excerpted explains that in DNA there is no gibberish. Every single 3-nucleotide sequence code (known as a codon) codes for an amino acid . There are no meaningless codons in DNA, no equivalent to gibberish.
Of course there are possible indicators of significance at the gene level. For instance, we recognize non-coding regions by the lack of start and stop codons. How does your specified complexity calculation take start and stop codons into account?
--Percy

This message is a reply to:
 Message 734 by havoc, posted 03-03-2011 4:49 PM havoc has not replied

New Cat's Eye
Inactive Member


Message 740 of 752 (607434)
03-03-2011 5:02 PM
Reply to: Message 737 by havoc
03-03-2011 4:56 PM


Re: et all
Code is code my friend. Can you name one code that has no code maker?
DNA.
There's also the Honey Bee Waggle Dance:
https://www.youtube.com/watch?v=-7ijI-g4jHg
Sorry that embedding was disabled.
quote:
Waggle dance is a term used in beekeeping and ethology for a particular figure-eight dance of the honey bee. By performing this dance, successful foragers can share with their hive mates information about the direction and distance to patches of flowers yielding nectar and pollen, to water sources, or to new housing locations.
Waggle dance - Wikipedia

This message is a reply to:
 Message 737 by havoc, posted 03-03-2011 4:56 PM havoc has not replied

Perdition
Member (Idle past 3266 days)
Posts: 1593
From: Wisconsin
Joined: 05-15-2003


Message 741 of 752 (607435)
03-03-2011 5:06 PM
Reply to: Message 734 by havoc
03-03-2011 4:49 PM


Re: et all
Realy so mutation is no longer random? Answer carefully your entire world view hangs in the balance.
I don't see how "So far as it causes no one else harm, allow people to behave how they want" will be affected by this at all. Since that's my "worldview" you seem to be barking up the wrong tree.
As for mutations being random, you're conflating two entirely different things.
AAG is a codon, a series of three nucleotides. This codon is a legitimate "word" in genetics as a certain amino acid is produced when RNA gets to this codon. In this case, it means lysine.
Now let's add a random mutation, It can be anything, say the G turns to another A, or to a C, or one of the As changes to a G or C, or a frameshift takes place, where the A's are shifted down one and the G before it turns the codon to GAA. These are all random pssibilities. Yet all of these codons code for something.
In fact, if the G were turned into an A, it would actually code for the exact same amino acid: Lysine. What I'm saying is that any random series of nucleotides will code for a protein (assuming the RNA is told to being reading). And changing any of those random nucleotides to another nucleotide will still code for a protein.
Now, that protein may or may not do what the previous one did, but that's where selection would come into play to determine if the this new protein was good, bad or indifferent as far as the animal's chances at life and procreation.
The mutations are random, but no matter what the mnutation is, it will still be a valid "sentence." There is no combination of nucleotides you can come up with that won't be valid.
So we did not know that hieroglyphics were language before finding the Rosetta stone? You guys are punishing yourselves to avoid the obvious. Language is language and code is code only because of specified complexity and nothing intrinsic in DNA would lead to this occurrence. And every known code has a code maker. This is just a fact of life.
Nope. That's not a fact of life. Every code that humans have made have been made by humans. That's tautological. Any codes not made by humans were not made by humans. That's also tautological. Show me a code not made by humans, and then show me the creator who made it.
And you still need to show exactly what specified complexity is and how you measure it. Until you do, you're saying gibberish.
I say codes are codes because of glorfang. I dare you to show me a code that doesn't have glorfang. If you can't, then you've just proven my argument.

This message is a reply to:
 Message 734 by havoc, posted 03-03-2011 4:49 PM havoc has not replied

Dr Adequate
Member (Idle past 313 days)
Posts: 16113
Joined: 07-20-2006


Message 742 of 752 (607436)
03-03-2011 5:15 PM
Reply to: Message 734 by havoc
03-03-2011 4:49 PM


Re: et all
So we did not know that hieroglyphics were language before finding the Rosetta stone?
Actually, some people thought they weren't.
Now, here's a puzzle for you. This is the Phaistos disc.
Some people think that it is a unique example of writing in an otherwise unknown script, and so presumably has meaning. Others think that it's a set of meaningless symbols that look like writing produced as an ingenious hoax on archaelogists. Perhaps some clever creationist could tell us which.
Once you're done with that, you could start in on the Voynich manuscript.
It's undoubtedly medieval, but is that a real language, possibly written in cipher, or was it just a hoax to appeal to a buyer of rare and exotic books, produced by writing the letters of the script at random?
You guys are punishing yourselves to avoid the obvious. Language is language and code is code only because of specified complexity and nothing intrinsic in DNA would lead to this occurrence. And every known code has a code maker. This is just a fact of life.
And possibly your post also has meaning, but it is difficult to detect.

This message is a reply to:
 Message 734 by havoc, posted 03-03-2011 4:49 PM havoc has not replied

Dr Adequate
Member (Idle past 313 days)
Posts: 16113
Joined: 07-20-2006


Message 743 of 752 (607437)
03-03-2011 5:23 PM
Reply to: Message 737 by havoc
03-03-2011 4:56 PM


Re: et all
Code is code my friend. Can you name one code that has no code maker?
Well, there's the so-called "genetic code".
Can you name one code that has a supernatural code-maker?
But what would your assumption that the code has a designer tell us about its content? How, for example, do we then distinguish between a string in that code that was the product of an intelligent being and a string in that code that is the product of evolution?
Edited by Dr Adequate, : No reason given.

This message is a reply to:
 Message 737 by havoc, posted 03-03-2011 4:56 PM havoc has not replied

Dr Adequate
Member (Idle past 313 days)
Posts: 16113
Joined: 07-20-2006


Message 744 of 752 (607438)
03-03-2011 5:26 PM
Reply to: Message 735 by havoc
03-03-2011 4:52 PM


Re: et all
Yes you an intellegent person could creat program that results in specified complexity.
Are you saying that the sentences randomly produced by my unintelligent computer would possess specified complexity?

This message is a reply to:
 Message 735 by havoc, posted 03-03-2011 4:52 PM havoc has not replied

Taq
Member
Posts: 10085
Joined: 03-06-2009
Member Rating: 5.1


Message 745 of 752 (607440)
03-03-2011 5:34 PM
Reply to: Message 725 by havoc
03-03-2011 4:20 PM


Re: et all
I have given you two different ways purposed to measure information content or specified complexity.
Then please use one of these methods to measure the information/SC content of this DNA sequence:
quote:
GCGTATCCTATATATTAAGTTAATTCTTATGGAATATAATAACATGTGGATG
GCCAGTGGTCGGTTGTTACACGCCTACCGCGATGCTGAATGACCCGGAC
TAGAGTGGCGAAATTTATGGCGTGTGACCCGTTATGCTCCATTTCGGTCAG
TGGGTCATTGCTAGTAGTCGATTGCATT GCCATTCTCCGAGTGATTTA
I have seen no one point to a better way to measuer it.
We have yet to see you measure information/SC.

This message is a reply to:
 Message 725 by havoc, posted 03-03-2011 4:20 PM havoc has not replied

Taq
Member
Posts: 10085
Joined: 03-06-2009
Member Rating: 5.1


Message 746 of 752 (607441)
03-03-2011 5:35 PM
Reply to: Message 737 by havoc
03-03-2011 4:56 PM


Re: et all
Can you name one code that has no code maker?
I can name many for which there is no known code maker, DNA and electron orbitals being two.
If you want to claim that a code requires an intelligence then it is up to you to demonstrate it.

This message is a reply to:
 Message 737 by havoc, posted 03-03-2011 4:56 PM havoc has not replied

Taq
Member
Posts: 10085
Joined: 03-06-2009
Member Rating: 5.1


Message 747 of 752 (607442)
03-03-2011 5:37 PM
Reply to: Message 735 by havoc
03-03-2011 4:52 PM


Re: et all
However an earth quake at the scrabble store will never write a novel.
No one is claiming that they do. We are talking about biology and evolution. Will you be joining this conversation?

This message is a reply to:
 Message 735 by havoc, posted 03-03-2011 4:52 PM havoc has not replied

Briterican
Member (Idle past 3978 days)
Posts: 340
Joined: 05-29-2008


Message 748 of 752 (607444)
03-03-2011 6:19 PM
Reply to: Message 727 by havoc
03-03-2011 4:28 PM


Re: Really stupid assertions
Havoc writes:
This would be explaind by Dembskis Law filter.
Dembski is possibly more of an idiot than Sarfati. No Free Lunch has been absolutely and completely shredded by the scientific community, and yet these arguments still come up.
Here are some examples from our friend Wikipedia why you cannot place any weight on Dembski's notion of specified complexity:
Dembski has used the terms "complexity", "information" and "improbability" interchangeably. These numbers measure properties of things of different types: Complexity measures how hard it is to describe an object (such as a bitstring), information measures how close to uniform a random probability distribution is and improbability measures how unlikely an event is given a probability distribution.
Dembski's calculations show how a simple smooth function cannot gain information. He therefore concludes that there must be a designer to obtain CSI. However, natural selection has a branching mapping from one to many (replication) followed by pruning mapping of the many back down to a few (selection). When information is replicated, some copies can be differently modified while others remain the same, allowing information to increase. These increasing and reductional mappings were not modeled by Dembski. In other words, Dembski's calculations do not model birth and death. This basic flaw in his modeling renders all of Dembski's subsequent calculations and reasoning in No Free Lunch irrelevant because his basic model does not reflect reality. Since the basis of No Free Lunch relies on this flawed argument, the entire thesis of the book collapses.
Critics maintain that Dembski uses "complex" as most people would use "absurdly improbable". They also claim that his argument is a tautology: CSI cannot occur naturally because Dembski has defined it thus.
...critics cite reports of evidence of the kind of evolutionary "spontanteous generation" that Dembski claims is too improbable to occur naturally. For example, in 1982, B.G. Hall published research demonstrating that after removing a gene that allows sugar digestion in certain bacteria, those bacteria, when grown in media rich in sugar, rapidly evolve new sugar-digesting enzymes to replace those removed.[24] Another widely cited example is the discovery of nylon eating bacteria that produce enzymes only useful for digesting synthetic materials that did not exist prior to the invention of nylon in 1935.
I cite these examples solely because you seem to be placing great reliance on the idea of "specified complexity" to insist that DNA is evidence of a designer, without fully appreciating how this concept put forward by Dembski holds no merit.
And the comment "An earthquake at the Scrabble store will never write a novel" is nothing more than a rehash of Hoyle's fallacy.

This message is a reply to:
 Message 727 by havoc, posted 03-03-2011 4:28 PM havoc has not replied

Perdition
Member (Idle past 3266 days)
Posts: 1593
From: Wisconsin
Joined: 05-15-2003


Message 749 of 752 (607452)
03-03-2011 6:58 PM
Reply to: Message 735 by havoc
03-03-2011 4:52 PM


Analogies
However an earth quake at the scrabble store will never write a novel.
This analogy is not, in fact, analogous to evolution. If you could understand this minor thing, it would be a huge step-forward in your ability to knowledgeabley debate this topic.
First of all, for an analogy to be vaild, it has to have the same basic number of factors as the thing it is supposed to be an analog of. Evolution has three, and your analogy only has two.
Evolution's three basic factors are:
Starting materials. In evolution, DNA, in your analogy, Scrabble pieces.
A randomizer. In evolution, mutations, in your analogy, an earthquake.
A weeder out of the bad and a keeper of the good. In evolution, natural selection, in your analogy, ????
So, your analogy doesn't work for evolution, so saying that something like it is impossible says nothing whatsoever about evolution.
We could add in the fact that evolution has thousands or millions or billions of iterations, whereas yours has at most a handful, depending on aftershocks and such, but it's not necessary to beat a dead horse. ;-)
Edited by Perdition, : Spelling

This message is a reply to:
 Message 735 by havoc, posted 03-03-2011 4:52 PM havoc has not replied

RAZD
Member (Idle past 1434 days)
Posts: 20714
From: the other end of the sidewalk
Joined: 03-14-2004


Message 750 of 752 (607454)
03-03-2011 7:17 PM
Reply to: Message 700 by Dr Adequate
03-02-2011 11:51 PM


methods of propulsion and spinning strings
Hi Dr Adequate.
Your argument is flawed. The small-scale dynamics of water are different from its large-scale fluid dynamics, because at a small scale its viscosity becomes a much more important factor while inertia becomes negligible. You'd have to test the bacterium against something of a similar size.
Not true, otherwise scale model testing of large ships would not work. The reason scale models are used in tow test tanks is because the effects can be corrected by using the Reynolds Numbers to adjust the effects.
Reynolds number - Wikipedia
quote:
In fluid mechanics, the Reynolds number Re is a dimensionless number that gives a measure of the ratio of inertial forces ρv2/L to viscous forces μv/L2 and consequently quantifies the relative importance of these two types of forces for given flow conditions. The concept was introduced by George Gabriel Stokes in 1851,[1] but the Reynolds number is named after Osborne Reynolds (1842—1912), who popularized its use in 1883.[2][3]
Reynolds numbers frequently arise when performing dimensional analysis of fluid dynamics problems, and as such can be used to determine dynamic similitude between different experimental cases. They are also used to characterize different flow regimes, such as laminar or turbulent flow: laminar flow occurs at low Reynolds numbers, where viscous forces are dominant, and is characterized by smooth, constant fluid motion, while turbulent flow occurs at high Reynolds numbers and is dominated by inertial forces, which tend to produce chaotic eddies, vortices and other flow instabilities.
Not that I want to do the calcualtions, but it could be done.
A 1" scale yellow pine tank-test model for the twelve-meter class America's Cup challenger Sceptre, circa 1958
quote:
A 1" scale yellow pine tank-test model for the twelve-meter class America's Cup challenger Sceptre, circa 1958

And, imho, no matter how small you do the testing, a propeller will still outperform a long spinning string that has a lot of extra surface drag in addition to little propelling surface.
This is because a propeller uses the lift effect as well as the push effect, say of a paddle, in contrast to the vortex drag that would form around a spinning string or hose that goes off in chaotic directions where most of the energy is wasted rather than used for propulsion.
This is why fish have paddles instead of string fins ... and eels use a flattened body that "snakes" back and forth in a plane perpendicular to the flattened body, rather than spin.
What you have, is once again a trait that is adapted from previous function/s to a new use, not because the end result is the best possible design, but because it is just adequate enough to do the job.
Enjoy.

we are limited in our ability to understand
by our ability to understand
Rebel American Zen Deist
... to learn ... to think ... to live ... to laugh ...
to share.


Join the effort to solve medical problems, AIDS/HIV, Cancer and more with Team EvC! (click)

This message is a reply to:
 Message 700 by Dr Adequate, posted 03-02-2011 11:51 PM Dr Adequate has replied

Replies to this message:
 Message 751 by Dr Adequate, posted 03-03-2011 7:45 PM RAZD has seen this message but not replied

Newer Topic | Older Topic
Jump to:


Copyright 2001-2023 by EvC Forum, All Rights Reserved

™ Version 4.2
Innovative software from Qwixotic © 2024