Understanding through Discussion


Welcome! You are not logged in. [ Login ]
EvC Forum active members: 66 (9057 total)
367 online now:
DrJones*, dwise1, nwr, PaulK, Theodoric (5 members, 362 visitors)
Newest Member: drlove
Post Volume: Total: 889,940 Year: 1,052/6,534 Month: 1,052/682 Week: 105/182 Day: 0/26 Hour: 0/1


Thread  Details

Email This Thread
Newer Topic | Older Topic
  
Author Topic:   The Common Ancestor?
Taq
Member
Posts: 8489
Joined: 03-06-2009


Message 5 of 341 (574786)
08-17-2010 8:27 PM
Reply to: Message 1 by Tram law
08-17-2010 2:42 PM


If there is a common ancestor to both humans and apes, has it been found?

If not, doesn't that call into question the existence of common ancestors?

The DNA evidence for a common ancestor is overwhelming (e.g. ERV's). Whether or not we have found a fossil specimen that is our ancestor (which we couldn't determine anyway since it would require a DNA sample) does not refute the DNA evidence.

To use an analogy, imagine a murder trial where the defendant's bloody fingerprints, DNA, and fibers were found at the scene of the crime. Would not finding the defendant's shoe prints refute any of this evidence?


This message is a reply to:
 Message 1 by Tram law, posted 08-17-2010 2:42 PM Tram law has not yet responded

Replies to this message:
 Message 6 by barbara, posted 09-22-2010 1:42 PM Taq has responded

  
Taq
Member
Posts: 8489
Joined: 03-06-2009


Message 9 of 341 (582664)
09-22-2010 4:05 PM
Reply to: Message 6 by barbara
09-22-2010 1:42 PM


Some of the journals that I have read state that humans are 96% the same as in chimps, gorillas, and orangutans.

Like others have stated, it depends on the comparison that you are making, but 96% across the entire Hominidae family is a good approximate number.

However, I also read that some of the retroviruses sequences are species specific in each one.

Yes, there are lineage specific insertions for every ape species, including humans. These are retroviral insertions that occurred since each lineage branched off from the common ancestor. However, we still share the ERV's that were part of the common ancestor's genome.

The neanderthal DNA also says we are 96% the same.

Again, depends on the comparison. If we ignore insertions and deletions of DNA I think the number is closer to 99% at the DNA base level.

There hasn't been any other species between Neanderthal and modern humans is there in the fossil record?

No, just like there isn't any dog variety that is between chihuahuas and great danes. Modern humans and neanderthals were cousins.


This message is a reply to:
 Message 6 by barbara, posted 09-22-2010 1:42 PM barbara has responded

Replies to this message:
 Message 12 by barbara, posted 09-23-2010 2:54 PM Taq has responded

  
Taq
Member
Posts: 8489
Joined: 03-06-2009


Message 13 of 341 (582823)
09-23-2010 4:07 PM
Reply to: Message 12 by barbara
09-23-2010 2:54 PM


If you ignore insertions and deletions of DNA in all species, would we be 99% the same?

No. The more distant the common ancestor between any two species ther more time there has been for the accumulation of point mutations. There are 3 ways that DNA can be modified (i.e. mutated). They are as follows:


Original DNA:
TTTAAAGGGCCC

Point mutation (a T is changed to a G):
TGTAAAGGGCCC

Insertion (the three C's at the beginning are inserted):
TTTCCCAAAGGGCCC

Deletion (the G's are deleted):
TTTAAACCC

Edited by Taq, : No reason given.


This message is a reply to:
 Message 12 by barbara, posted 09-23-2010 2:54 PM barbara has responded

Replies to this message:
 Message 38 by barbara, posted 09-26-2010 11:18 PM Taq has responded

  
Taq
Member
Posts: 8489
Joined: 03-06-2009


Message 27 of 341 (583031)
09-24-2010 11:05 AM
Reply to: Message 14 by Jon
09-23-2010 5:03 PM


Re: Bad Analogies = Bad Science
All this business of common ancestry makes the process look clean and simple. Reality: it's a muddled mess.

Just about every concept in biology is plagued by the same problem. As I often like to say, biology is messy.

But as you say in a subsequent post, if we jump through time in bigger jumps it is obvious. At one point there is an interbreeding population. When we come back at a much later time there are now two populations that do not interbreed with all members in both populations being able to trace their lineages back to members of that past population.

To use another analogy, there is no obvious demarcation between tall and short but all of us can agree that Danny DeVito is short and Shaquille O'Neal is tall. Taxonomy, the definition of species, and the very process of speciation are plagued by the same problems. With very fine resolution it is really hard to tease out the differences, but with the long lens of time we can see the obvious trends.


This message is a reply to:
 Message 14 by Jon, posted 09-23-2010 5:03 PM Jon has not yet responded

  
Taq
Member
Posts: 8489
Joined: 03-06-2009


Message 34 of 341 (583051)
09-24-2010 1:06 PM
Reply to: Message 29 by Jon
09-24-2010 11:59 AM


Re: Bad Analogies = Bad Science
I think every time we go back we're going to undoubtedly find input again from even earlier generations, requiring that we go back to that generation as the 'common ancestor'. But even this generation will have input from earlier ones, requiring that we again step back further in time.

But we can still state that ALL members of generation B have ancestors in an earlier generation A, can we not?

Let's look at humans and chimps. When we say that humans and chimps share a common ancestor, or more accurately a common ancestral pool, we are saying that at one point in history there existed a single generation of interbreeding individuals. All humans and all chimps can trace their lineages back to members of that single generation.

When this is the meaning folk begin putting on to the term, it becomes necessary to point out that their notion of 'common ancestor' is a fantasized non-existent entity/species/generation.

I think "hypothetical" is a much better term than fantasized or non-existent.


This message is a reply to:
 Message 29 by Jon, posted 09-24-2010 11:59 AM Jon has responded

Replies to this message:
 Message 36 by Jon, posted 09-24-2010 5:14 PM Taq has not yet responded
 Message 61 by barbara, posted 09-28-2010 1:52 AM Taq has not yet responded

  
Taq
Member
Posts: 8489
Joined: 03-06-2009


Message 48 of 341 (583469)
09-27-2010 3:14 PM
Reply to: Message 38 by barbara
09-26-2010 11:18 PM


Re: Deletions
How do you know it was deleted if it is no longer there anymore? The same question for insertions, how do you know that it wasn't always there in a genome sequence?

You can use a third species such as the gorilla. Even without a third species you can tell that DNA has either been deleted in one lineage or added in another because of the homology on either side of the indel. For example, below is a mock comparison of random sequence. Indels are marked by dashes:


Human
AAATTGTTGCCG---ATGCCCCAGTTGT
AAATTGTTGCCGTTCATGCCCCAGTTGT
Chimp

Whether the TTC was deleted in the human lineage or inserted in the chimp lineage can not be determined by this comparison alone which is why it is called an indel (insertion and deletion combined). However, if we add the gorilla sequence we can learn more:

Human
AAATTGTTGCCG---ATGCCCCAGTTGT
AAATTGTTGCCGTTCATGCCCCAGTTGT
Chimp
Gorilla
AAATTGTTGCCG---ATGCCCCAGTTGT

From this comparison we can determine that the TTC was inserted in the chimp lineage.


This message is a reply to:
 Message 38 by barbara, posted 09-26-2010 11:18 PM barbara has responded

Replies to this message:
 Message 60 by barbara, posted 09-28-2010 1:44 AM Taq has not yet responded

  
Taq
Member
Posts: 8489
Joined: 03-06-2009


Message 49 of 341 (583470)
09-27-2010 3:18 PM
Reply to: Message 41 by Strongbow
09-27-2010 9:33 AM


Re: Definitions & Feel-good Science
hat is on possible definition of species, but not comprehensive, and maybe not even accurate.

The important concept here is gene flow. Whether or not two species can produce fertile offspring is not important. What is important is do they produce fertile offspring when given the chance. What we want to know is if mutations can flow freely from one population to the other. If not, then the populations are diverging.

Of course, this definition only applies to living species who reproduce sexually. This doesn't apply to things such as fossil species or bacteria.


This message is a reply to:
 Message 41 by Strongbow, posted 09-27-2010 9:33 AM Strongbow has responded

Replies to this message:
 Message 51 by Strongbow, posted 09-27-2010 3:50 PM Taq has not yet responded

  
Taq
Member
Posts: 8489
Joined: 03-06-2009


Message 50 of 341 (583471)
09-27-2010 3:21 PM
Reply to: Message 44 by barbara
09-27-2010 2:22 PM


Re: Bad Analogies = Bad Science
I agree that "common ancestry" should not be used since it is too messy and it is based on speculation.

I disagree. The term "common ancestry" should be used correctly. Also, common ancestry is not based on speculation. It is based on evidence.


This message is a reply to:
 Message 44 by barbara, posted 09-27-2010 2:22 PM barbara has not yet responded

  
Taq
Member
Posts: 8489
Joined: 03-06-2009


Message 75 of 341 (583653)
09-28-2010 12:08 PM
Reply to: Message 53 by Jon
09-27-2010 7:39 PM


Re: The most recent common ancestor
Indeed, and it is the time aspect that confuses me. How far back do we go to look for a common ancestor? What is recent?

Conceptually, we are looking for the most recent ancestor. In the case of humans and chimps, we are looking for the most recent interbreeding population that contained all of the ancestors of both living humans and living chimps.

This is not to be confused with common ancestry of a single gene. I think this is where the confusion is occuring. It is very probable that the common ancestor of a shared chimp/human gene is much older than the members of the most recent common ancestral population.

What is the agreed-upon most recent common ancestor - using the term cautiously - for humans and chimpanzees?

Without DNA from 5-7 million year old hominid fossils it is impossible to determine.

I've seen some names thrown around here, but maybe we can look at the features and characteristics of these ancestors and compare them to present humans and chimps and ancestral humans and chimps to see how the common ancestor relates to both modern populations and to the populations of its daughter species "shortly after the lineages diverged" (to use phrasing by PaulK).

Then we are only looking at the species that contains the most synapomorphies which still does not guarantee direct ancestry to any living organism, human or chimp. DNA is the only way to establish direct ancestry.


This message is a reply to:
 Message 53 by Jon, posted 09-27-2010 7:39 PM Jon has responded

Replies to this message:
 Message 77 by Jon, posted 09-28-2010 12:41 PM Taq has not yet responded

  
Taq
Member
Posts: 8489
Joined: 03-06-2009


Message 129 of 341 (585526)
10-08-2010 3:37 PM
Reply to: Message 123 by barbara
10-08-2010 12:13 PM


Re: Time Tree : : Timescale of Life
The confusion is that all of these critters that split with humans is indicating that we once were able to breed with these species.

How could I have bred with any other species millions of years ago? I know I am getting older, but you are really making me self-conscious. Do I really look that old to you?


This message is a reply to:
 Message 123 by barbara, posted 10-08-2010 12:13 PM barbara has not yet responded

  
Taq
Member
Posts: 8489
Joined: 03-06-2009


Message 130 of 341 (585528)
10-08-2010 3:40 PM
Reply to: Message 128 by barbara
10-08-2010 3:12 PM


Re: Time Tree : : Timescale of Life
I have absolutely no clue what common ancestry means.

It means having an ancestor in common like you and your cousins have your grandparents as a common ancestor.

I do not understand when the Time Tree says a different date for mitochondria that is not the same as the nuclear date.

Different data sets. Mitochondria and the nuclear genome accumulate mutations at different rates so knowing both estimates gives us a better overall estimate.

How can they evolve separately when they are part of the same organism?

They each have their own sets of DNA polymerases and DNA error correction systems (if memory serves). This results in different rates and patterns of accumulated mutations.


This message is a reply to:
 Message 128 by barbara, posted 10-08-2010 3:12 PM barbara has not yet responded

  
Taq
Member
Posts: 8489
Joined: 03-06-2009


Message 131 of 341 (585531)
10-08-2010 3:44 PM
Reply to: Message 125 by barbara
10-08-2010 1:06 PM


Re: Time Tree : : Timescale of Life
You might as well state that we are all related by "name unknown" ancestrial breeding pair of a mouse/Human split because we at least can identify the mouse.

French, Italian, and Spanish are all descendants of the Latin language. Does this mean that at one time the Italians spoke French, or that the ancient Romans spoke Spanish? No. These languages share a common ancestor: Latin. Each language branch accumulated different changes over time resulting in three populations that can no longer understand each other's native tongue.

It is the same for us and mice. Our common ancestor was neither a mouse nor a human. When our lineages split each lineage started accumulating different changes resulting in each lineage looking less and less like the other. The END RESULT of this process is mice and humans just as the end result of the evolution of the Romance languages is French, Italian, and Spanish (amongst others).


This message is a reply to:
 Message 125 by barbara, posted 10-08-2010 1:06 PM barbara has not yet responded

  
Taq
Member
Posts: 8489
Joined: 03-06-2009


Message 144 of 341 (586949)
10-15-2010 5:02 PM
Reply to: Message 143 by barbara
10-15-2010 4:29 PM


Re: Time Tree : : Timescale of Life
What information is genes telling you?

The same information that everything in the universe has. Humans look at stuff and extract information from them in order to determine their state and their origin. This is true of rocks, clouds, and life. Same type of information in all of them.

My understanding is you are only able to see what the protein makes in the form of bone, tissue etc.

We are able to determine the DNA sequence which tells us how long it has been since two species shared a common ancestor. The more distant that common ancestor the more the DNA sequences for a shared gene will differ.

Considering that most species do share the same proteins because we share the same parts, wouldn't this make the connection between them harder to determine?

It would be harder if they DIDN'T share any parts.


This message is a reply to:
 Message 143 by barbara, posted 10-15-2010 4:29 PM barbara has not yet responded

  
Taq
Member
Posts: 8489
Joined: 03-06-2009


Message 172 of 341 (587365)
10-18-2010 3:06 PM
Reply to: Message 150 by frako
10-16-2010 5:47 AM


Re: Time Tree : : Timescale of Life
If this where true, transfering Jellyfish Genes, the ones that make them glow in the dark, to rats would not make rats glow in the dark. Guess what they made fluorescent rats, so gens hold information.

If you fed rats methanol and exposed them to light they would go blind. Does this mean that methanol carries the information for blindness?


This message is a reply to:
 Message 150 by frako, posted 10-16-2010 5:47 AM frako has not yet responded

  
Taq
Member
Posts: 8489
Joined: 03-06-2009


(1)
Message 173 of 341 (587366)
10-18-2010 3:09 PM
Reply to: Message 171 by barbara
10-18-2010 1:47 PM


Re: Time Tree : : Timescale of Life
If life does not equate to abstract then why does one think that humans are the exception?

DNA is not an abstraction. If we replaced the DNA molecule with a very tiny piece of ticker tape with letters typed on it we would no longer have a viable cell. However, with abstract human language we can change the physical state of the letters in any medium and still convey the same abstract information.

For DNA it is the chemistry that matters. This is not so with abstract information created by intelligent species like our species.


This message is a reply to:
 Message 171 by barbara, posted 10-18-2010 1:47 PM barbara has not yet responded

  
Newer Topic | Older Topic
Jump to:


Copyright 2001-2018 by EvC Forum, All Rights Reserved

™ Version 4.0 Beta
Innovative software from Qwixotic © 2022