Understanding through Discussion


Welcome! You are not logged in. [ Login ]
EvC Forum active members: 62 (9041 total)
80 online now:
kjsimons, PaulK, Tangle (3 members, 77 visitors)
Newest Member: maria
Post Volume: Total: 885,913 Year: 3,559/14,102 Month: 179/321 Week: 39/59 Day: 0/4 Hour: 0/0


Thread  Details

Email This Thread
Newer Topic | Older Topic
  
Author Topic:   Intelligent Design just a question for evolutionists
Taq
Member
Posts: 8482
Joined: 03-06-2009


(1)
Message 27 of 146 (792341)
10-07-2016 10:48 AM
Reply to: Message 18 by Genomicus
10-07-2016 6:14 AM


Re: Life Looks Engineered
Genomicus writes:

When we go into the realm of molecular biology, the appearance of engineering only strengthens.

What we also need to remember is how unreliable appearances are. At one time, the Sun appeared to move about the Earth instead of the Earth moving about the Sun. I can look up into the sky and find clouds that have the appearance of ducks or dragons. That doesn't mean there are dragons flying through the air.

The whole point of science, and the reason it has been so successful, is that it ignores appearances. Appearances are nothing more than human biases.

What we have instead are phylogenies that span billions of years. That is evidence independent of any appearances. Those are facts, and those facts falsify intelligent design as described by ID proponents.

Edited by Taq, : No reason given.


This message is a reply to:
 Message 18 by Genomicus, posted 10-07-2016 6:14 AM Genomicus has responded

Replies to this message:
 Message 32 by Genomicus, posted 10-07-2016 11:08 AM Taq has responded

  
Taq
Member
Posts: 8482
Joined: 03-06-2009


(1)
Message 29 of 146 (792343)
10-07-2016 10:56 AM
Reply to: Message 21 by mike the wiz
10-07-2016 6:25 AM


Re: Life Looks Engineered
mike the wiz writes:

Genomicus, your comment, "appear" is a question-begging-epithet. I could also say, "why then do Ferraris appear to be designed".

When do Ferrari's mate and produce offspring that are imperfect copies of their parents?

When do we see populations of breeding Ferrari's evolve right before our eyes?

When do we see millions of species of Ferrari's forming statistically supported phylogenies?

The features of specified complexity, contingency planning, are really in the anatomy, like they are really in a car, so your argument is SPECIAL PLEADING - you are asking me to treat actual intelligent design as appearance, in lifeforms, but as design in a car, even though in both the car and the eyeball, the specified complexity is present, meaning an eyeball is constructed to give vision, OVERTLY upon investigation, and a car is constructed to drive, OVERTLY, by investigation. If an eyeball and a car is not constructed to drive then we could DESTROY the arrangement of parts in both and they would still function.

No ID proponent has ever been able to detect complex specified information in biology using a scientific and falsifiable model of CSI. If you think I am wrong, then please measure the complex specified information in this DNA sequence:

TAACTCGATCAGTCACTCGCTATTCGAACTGGGCGAAAGATCCCAGCGCT
CATGCACTTGATCCCGAGGCCTGACCCGATATATGAGCTCAGACTAGAGC

The reason that Paley's argument is not taken seriously is that it has already been disproven by science. The reason that ID is labeled as creationism is simple. The only reason ID is being pushed is because of the theological beliefs of those pushing it. ID has no explanatory power. ID has already been falsified by science. Even the proponents of ID admit that the reason they are pushing ID is to evangelize.

Edited by Taq, : No reason given.

Edited by Admin, : Break long line in middle.


This message is a reply to:
 Message 21 by mike the wiz, posted 10-07-2016 6:25 AM mike the wiz has not yet responded

  
Taq
Member
Posts: 8482
Joined: 03-06-2009


Message 31 of 146 (792345)
10-07-2016 11:00 AM
Reply to: Message 30 by Genomicus
10-07-2016 10:56 AM


Genomicus writes:

Not sure if you're referring strictly to DNA as a molecule here, in and of itself, or the whole genetic code. Because when it comes to the genetic code, there's plenty that's similar to it -- phenomena which we know are the products of agency. The canonical genetic code is a code in a very real sense -- this isn't metaphorical language employed by biologists. And codes and data transmission -- complete with error-correcting mechanisms, parity structure, etc. -- are known to be the products of intelligence.

Arcs of electricity are known to be the product of human intelligence and design. That doesn't mean that lightning is the product of design.

Just because humans make certain things does not mean that they can't be produced by nature.


This message is a reply to:
 Message 30 by Genomicus, posted 10-07-2016 10:56 AM Genomicus has responded

Replies to this message:
 Message 33 by Genomicus, posted 10-07-2016 11:16 AM Taq has responded

  
Taq
Member
Posts: 8482
Joined: 03-06-2009


(1)
Message 34 of 146 (792348)
10-07-2016 11:21 AM
Reply to: Message 32 by Genomicus
10-07-2016 11:08 AM


Re: Life Looks Engineered
Genomicus writes:

I get your point, but IMHO it's a bit of stretch to equate perceived phantasmagoria in the clouds with what we see in biology. When we say that cells have molecular machines, we actually mean that they have machines. This isn't metaphorical language -- and the same is true for genetic codes.

You could just as well claim that clouds are lightning machines, or that the Sun is a fusion machine.

But let me add a bit more nuance to this. To take your example of dragon-like clouds: what happens when we hone in on those images in the clouds in more depth? The images start looking less like dragons and more like ordinary masses of atmospheric gases. In other words, under higher resolution, the appearances fall away.

Humans also produce masses of atmospheric gases. So does this mean that all masses of atmospheric gases are made by an intelligence?

But this isn't so for life. When we look at life under increasingly higher resolutions, the deeper the engineering analogy becomes. There are actual machines with discrete, modular parts. At a core, basal level, there are systems that smack of rational design -- systems and machines that are not reflective of hodge-podge, jury-rigged Neo-Darwinian co-option mechanisms.

That is true of any chemical reaction. You can label oxygen and hydrogen molecules as machines, and call them water machines when they are in the presence of enough energy to catalyze the reaction that leads to water.

But it does mean that it makes sense to be suspicious that teleology has played a role in the origin of life. We can then take that as a working hypothesis, further refine it, and see where the hypothesis' predictions and explanatory powers takes us.

We already did that. ID lost. ID can't explain basic observations in biology, such as the fossil record, observed morphological phylogenies, or patterns of genetic divergence. Evolution can explain these things.


This message is a reply to:
 Message 32 by Genomicus, posted 10-07-2016 11:08 AM Genomicus has responded

Replies to this message:
 Message 36 by Genomicus, posted 10-07-2016 12:01 PM Taq has responded
 Message 37 by Genomicus, posted 10-07-2016 12:08 PM Taq has responded

  
Taq
Member
Posts: 8482
Joined: 03-06-2009


Message 35 of 146 (792349)
10-07-2016 11:23 AM
Reply to: Message 33 by Genomicus
10-07-2016 11:16 AM


Genomicus writes:

I daresay most molecular and computational biologists would disagree with this assessment that DNA (if we mean a genetic code, and not just the molecule itself) doesn't strongly resemble anything we know to be designed by intelligence.

Based on what arguments?


This message is a reply to:
 Message 33 by Genomicus, posted 10-07-2016 11:16 AM Genomicus has responded

Replies to this message:
 Message 41 by Genomicus, posted 10-07-2016 12:41 PM Taq has responded

  
Taq
Member
Posts: 8482
Joined: 03-06-2009


Message 44 of 146 (792358)
10-07-2016 12:51 PM
Reply to: Message 41 by Genomicus
10-07-2016 12:41 PM


Genomicus writes:

Most molecular biologists -- I suspect, based on what's been published in the scientific literature -- would comfortably assert that the genetic code resembles human-designed codes and data transmission systems.

What do they base these assertions on?

For example, you don't stop a computer program by folding the hard drive into a 3 dimensional structure like a stem loop. However, that is how DNA works. You also don't make programs where programs are turned on by the ability of one part of the hard drive to physically bind to another part of the hard drive, and yet that is exactly how DNA works.


This message is a reply to:
 Message 41 by Genomicus, posted 10-07-2016 12:41 PM Genomicus has not yet responded

  
Taq
Member
Posts: 8482
Joined: 03-06-2009


Message 45 of 146 (792359)
10-07-2016 12:52 PM
Reply to: Message 37 by Genomicus
10-07-2016 12:08 PM


Re: Life Looks Engineered
Genomicus writes:

A hypothesis of agency in the origin of life need not conflict with the modern evolutionary synthesis.

We aren't talking about the origin of life. We are talking about modern species.


This message is a reply to:
 Message 37 by Genomicus, posted 10-07-2016 12:08 PM Genomicus has not yet responded

  
Taq
Member
Posts: 8482
Joined: 03-06-2009


Message 48 of 146 (792362)
10-07-2016 12:58 PM
Reply to: Message 36 by Genomicus
10-07-2016 12:01 PM


Re: Life Looks Engineered
Genomicus writes:

Sure, but those metaphors won't take you very far in terms of making sense of these phenomena.

And they don't take us very far in biology, either.

My statement was regarding whether your hypothetical cloud-dragon would still look like a dragon under higher resolution, not whether those clouds were intelligently designed.

Does this high resolution look at a protein look designed, or just like a mass of atoms?

That is a protein. You are claiming that they look like machines. What machine does that look like?

Again, calling oxygen and hydrogen "water machines" doesn't actually help us make sense of chemistry.

It doesn't help us in biology, either.

It is only biology, it seems, that requires engineering language in order to shed more light on various biological systems and phenomena.

It isn't required.


This message is a reply to:
 Message 36 by Genomicus, posted 10-07-2016 12:01 PM Genomicus has responded

Replies to this message:
 Message 50 by Genomicus, posted 10-07-2016 1:15 PM Taq has responded

  
Taq
Member
Posts: 8482
Joined: 03-06-2009


Message 53 of 146 (792367)
10-07-2016 2:53 PM
Reply to: Message 50 by Genomicus
10-07-2016 1:15 PM


Re: Life Looks Engineered
Genomicus writes:

Then why exactly is the molecular biology literature replete with terminology borrowed from engineering disciplines?

You are begging the question. You would first have to show that it is replete with terminology borrowed from engineering disciplines.

Umm, that looks like a sophisticated two-part machine with interlocking modules.

Show me a machine that looks anything like that. I bet you can't do it.

Really? Then tell that to published biologists who extensively use terminology borrowed from engineering disciplines.

Begging the question again.

Edited by Taq, : No reason given.


This message is a reply to:
 Message 50 by Genomicus, posted 10-07-2016 1:15 PM Genomicus has not yet responded

  
Taq
Member
Posts: 8482
Joined: 03-06-2009


Message 54 of 146 (792368)
10-07-2016 2:56 PM
Reply to: Message 46 by Genomicus
10-07-2016 12:54 PM


Re: Life Looks Engineered
Genomicus writes:

For example, the hypothesis of eukaryotic front-loading explains why core eukaryotic proteins have well-conserved structural and sequence protein homologs in prokaryotes, as opposed to some of these essential proteins having been cobbled together from non-functional stretches of prokaryotic genomes (e.g., pseudogenes).

How does it explain that?


This message is a reply to:
 Message 46 by Genomicus, posted 10-07-2016 12:54 PM Genomicus has not yet responded

  
Taq
Member
Posts: 8482
Joined: 03-06-2009


Message 76 of 146 (792563)
10-11-2016 4:33 PM
Reply to: Message 61 by Genomicus
10-08-2016 11:04 AM


Arguments from analogy are perfectly reasonable.

Arguments from analogy are logical fallacies.

http://onegoodmove.org/fallacy/falsean.htm


This message is a reply to:
 Message 61 by Genomicus, posted 10-08-2016 11:04 AM Genomicus has not yet responded

  
Taq
Member
Posts: 8482
Joined: 03-06-2009


Message 77 of 146 (792564)
10-11-2016 4:50 PM
Reply to: Message 58 by Percy
10-08-2016 8:31 AM


Re: Life Looks Engineered
Percy writes:

Obviously it does not look like a machine. The image you offerred yourself *does* look machine-like because it was the intended purpose of the drawing to make masses of molecules look machine-like, likely as an aid to understanding. Your image was taken from ATP Synthase:

Out of curiosity, I googled the crystal structure for ATP synthase and found this:

I have seen used pieces of bubble gum on the sidewalk that look more like a machine than that.

Edited by Taq, : No reason given.


This message is a reply to:
 Message 58 by Percy, posted 10-08-2016 8:31 AM Percy has acknowledged this reply

Replies to this message:
 Message 78 by New Cat's Eye, posted 10-11-2016 5:15 PM Taq has responded
 Message 80 by JonF, posted 10-11-2016 9:33 PM Taq has responded
 Message 82 by Pressie, posted 10-12-2016 8:44 AM Taq has not yet responded
 Message 113 by Genomicus, posted 11-02-2016 8:08 PM Taq has not yet responded

  
Taq
Member
Posts: 8482
Joined: 03-06-2009


Message 79 of 146 (792572)
10-11-2016 5:44 PM
Reply to: Message 78 by New Cat's Eye
10-11-2016 5:15 PM


Re: Life Looks Engineered
Cat Sci writes:

Wait, doesn't a wedge technically count as a machine?

Are ID/creationists arguing that proteins are designed because they look like wedges?


This message is a reply to:
 Message 78 by New Cat's Eye, posted 10-11-2016 5:15 PM New Cat's Eye has responded

Replies to this message:
 Message 83 by New Cat's Eye, posted 10-12-2016 10:20 AM Taq has not yet responded

  
Taq
Member
Posts: 8482
Joined: 03-06-2009


(3)
Message 85 of 146 (792659)
10-12-2016 4:47 PM
Reply to: Message 80 by JonF
10-11-2016 9:33 PM


Re: Life Looks Engineered
JonF writes:

I dunno, the blob on the bottom could be a stationary motor housing, the middle part an axle, and the top part a colorful rotating assemblage to entertain an infant.

Just as this could be a duck.


This message is a reply to:
 Message 80 by JonF, posted 10-11-2016 9:33 PM JonF has responded

Replies to this message:
 Message 86 by JonF, posted 10-12-2016 9:27 PM Taq has not yet responded
 Message 89 by mike the wiz, posted 10-30-2016 7:49 AM Taq has not yet responded

  
Taq
Member
Posts: 8482
Joined: 03-06-2009


(2)
Message 97 of 146 (793513)
10-31-2016 4:38 PM
Reply to: Message 88 by mike the wiz
10-30-2016 7:39 AM


mike the wiz writes:

1. The elements of intelligent design make something designed.

Your premise is indistinguishable from your conclusion. This is called "begging the question".

We don't agree that all things that looked designed were the product of intelligent design. You need to support your premise before we can proceed. You need to demonstrate, with evidence, that the design in life was produced by intelligent designers.


This message is a reply to:
 Message 88 by mike the wiz, posted 10-30-2016 7:39 AM mike the wiz has not yet responded

  
Newer Topic | Older Topic
Jump to:


Copyright 2001-2018 by EvC Forum, All Rights Reserved

™ Version 4.0 Beta
Innovative software from Qwixotic © 2021