Understanding through Discussion


Welcome! You are not logged in. [ Login ]
EvC Forum active members: 66 (9049 total)
87 online now:
nwr (1 member, 86 visitors)
Newest Member: Wes johnson
Upcoming Birthdays: Coragyps
Post Volume: Total: 887,675 Year: 5,321/14,102 Month: 242/677 Week: 47/54 Day: 0/4 Hour: 0/0


Thread  Details

Email This Thread
Newer Topic | Older Topic
  
Author Topic:   Micro v. Macro Creationist Challenge
Taq
Member
Posts: 8488
Joined: 03-06-2009
Member Rating: 7.4


Message 1 of 252 (809971)
05-22-2017 12:55 PM


For creationists who claim that microevolution and macroevolution are two different things, here is a simple challenge:

Show us a single genetic difference between the human and chimp genome that could not have been produced by known microevolutionary processes in either the chimp or human lineages.

Just for clarity, I am defining a microevolutionary change as a single mutational event (e.g. base substitution, insertion, deletion, transposon insertion, retroviral insertion, or genetic recombination) that is passed on to descendants.

As an example, here is a comparison of portion of the human HNF1 homeobox A gene and the homologous chimp gene:

Query  1     GGCCCTGTGGCAGCCGAGCCATGGTTTCTAAACTGAGCCAGCTGCAGACGGAGCTCCTGG  60
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct 1100 GGCCCTGTGGCAGCCGAGCCATGGTTTCTAAACTGAGCCAGCTGCAGACGGAGCTCCTGG 1159

Query 61 CGGCCCTGCTGGAGTCAGGGCTGAGCAAAGAGGCACTGCTCCAGGCACTGGGTGAGCCGG 120
|||||||||| ||||||||||||||||||||||||||| |||||||||||||||||||||
Sbjct 1160 CGGCCCTGCTCGAGTCAGGGCTGAGCAAAGAGGCACTGATCCAGGCACTGGGTGAGCCGG 1219

Query 121 GGCCCTACCTCCTGGCTGGAGAAGGCCCCCTGGACAAGGGGGAGTCCTGCGGCGGCGGTC 180
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct 1220 GGCCCTACCTCCTGGCTGGAGAAGGCCCCCTGGACAAGGGGGAGTCCTGCGGCGGCGGTC 1279

The human sequence is on top, and the chimp sequence is on the bottom. The "|" symbols indicate where the two sequences are the same. As you can see, there are two base substitutions in the middle row.

Can any creationist give us a single reason why two microevolutionary events could not produce those two base differences? Can creationists point to any different in the chimp and human genomes that could not be produced microevolution?

To admin: Would prefer placement in the Biological Evolution forum.

Edited by Taq, : No reason given.

Edited by Taq, : No reason given.


Replies to this message:
 Message 3 by RAZD, posted 05-22-2017 2:24 PM Taq has not yet responded
 Message 9 by CRR, posted 05-25-2017 12:12 AM Taq has responded
 Message 12 by aristotle, posted 06-16-2017 4:19 AM Taq has responded
 Message 50 by mike the wiz, posted 07-02-2017 12:46 PM Taq has responded
 Message 74 by CRR, posted 07-09-2017 7:59 PM Taq has responded

  
Taq
Member
Posts: 8488
Joined: 03-06-2009
Member Rating: 7.4


(1)
Message 4 of 252 (810117)
05-23-2017 4:59 PM


Chimp or Human Mutations?
Just for fun, I compared the chimp sequence to the gorilla sequence to figure out if those two mutations occurred in the chimp or human lineages. If the chimp and gorilla sequence is the same then the mutation happened in the human lineage. If the human and gorilla sequence is the same, then the mutation occurred in the chimp lineage.

As it turns out, the first mutation in the opening post is specific to the chimp lineage, and the second mutation is specific to the human lineage (using BLASTn).


Replies to this message:
 Message 5 by RAZD, posted 05-24-2017 7:54 AM Taq has responded

  
Taq
Member
Posts: 8488
Joined: 03-06-2009
Member Rating: 7.4


Message 6 of 252 (810160)
05-24-2017 10:52 AM
Reply to: Message 5 by RAZD
05-24-2017 7:54 AM


Re: Chimp or Human Mutations?
RAZD writes:

Are you sure about those time stamps at the bottom? I thought human/chimp split was ~10MYA, and this puts the split square in the lap of Ardipithecus ramidus and Ardipithecus kadabba:

A quick scan of a Google Scholar search seems to show that recent papers are still using divergence times of around 4-6 million years, with some papers going even as high as 8 MYA. I would suspect that 10 MYA would be an outlier with respect to the consensus.

As to Ardipithecus, it may push the common ancestor more towards the 6 MYA side of the equation than the 4 MYA.


This message is a reply to:
 Message 5 by RAZD, posted 05-24-2017 7:54 AM RAZD has responded

Replies to this message:
 Message 7 by RAZD, posted 05-24-2017 2:57 PM Taq has responded

  
Taq
Member
Posts: 8488
Joined: 03-06-2009
Member Rating: 7.4


(1)
Message 8 of 252 (810171)
05-24-2017 4:30 PM
Reply to: Message 7 by RAZD
05-24-2017 2:57 PM


Re: Chimp or Human Mutations?
RAZD writes:

Or it is just old. I remember speculating when Sahelanthropus tchadensis was found that it could be the common ancestor with chimps.

Could be.

For the time being, however, the actual dates are somewhat irrelevant. What matters for the gorilla/chimp/human triad is that the chimp/human lineage diverged from the gorilla lineage followed by humans and chimps diverging into their own lineages. This is what allows us to model the common ancestral genome and assign mutations to either the human or chimp lineage. Of course, incomplete lineage sorting can cause some inconsistencies, but for now we are going to go with a simple model.


This message is a reply to:
 Message 7 by RAZD, posted 05-24-2017 2:57 PM RAZD has acknowledged this reply

  
Taq
Member
Posts: 8488
Joined: 03-06-2009
Member Rating: 7.4


(1)
Message 11 of 252 (810206)
05-25-2017 11:00 AM
Reply to: Message 9 by CRR
05-25-2017 12:12 AM


Re: No Contest
CRR writes:

Since you have put no bounds on the starting assumptions and you have made your definition of microevolution so broad, anything could be "explained".

The bounds are the chimp and human genomes. What I am asking is if humans and chimps share a common ancestor, which genetic differences between them are you saying couldn't be produced by the observed mechanisms of mutagenesis.

mutagenesis = production of mutations

The major types of mutations are substitutions, insertions, deletions, transposon or retroviral insertion, and genetic recombination. A google search for those terms should give you all the definitions and descriptions that you need. If you have questions, please ask.

Microevolution occurs when a single mutation is passed on to subsequent generations and either increases or decreases in frequency over multiple generations.

Macroevolution occurs when two separate populations do not freely interbreed causing different microevolutionary events to accumulate in each of populations. This causes the populations to become different from one another over time, as is the case for humans and chimps.

Creationists claim that microevolutionary events can not accumulate to the point where they produce the genetic differences seen between separate species. I am using the human and chimp genomes as our specific example, and challenging creationists to point to a single genetic difference between the chimp and human genomes that could not be produced by a microevolutionary event. They must also explain what would stop mutations from accumulating over time since every generation is born with new mutations.


This message is a reply to:
 Message 9 by CRR, posted 05-25-2017 12:12 AM CRR has not yet responded

  
Taq
Member
Posts: 8488
Joined: 03-06-2009
Member Rating: 7.4


Message 24 of 252 (812465)
06-16-2017 4:48 PM
Reply to: Message 12 by aristotle
06-16-2017 4:19 AM


Aristotle writes:

Do you truly think it fair expecting creationists to prove the changes were not the result of mutations, when you can't prove that they were?

(for this thread I am going to use the word "prove" in the form of "prove beyond a reasonable doubt")

Creationists are the ones who are claiming that mutations can't produce the biodiversity we see today, so it is incumbent on them to show that these differences could not be produced by mutations.

As to proving that these were caused by mutations, this proof is found in the divergence rates of exons and introns/junk DNA. The removal of deleterious mutations in functional DNA is the proof that these were random mutations.

That asked, the chances of the mutations required between human and primate, occurring in the right gene and often enough in the population to change the genome of the entire species, are next to naught.

You are drawing the bulls eye around the arrow.

Let's use the lottery as an example. Lets say that the odds of winning are 1 in 100 million. For each lottery 100 million tickets are bought by 100 million people. For each lottery there is 1 winner. The winners of those lotteries are Frank, Susan, Mark, and Joanne. What are the odds that those specific four people would win? That would be 100 million to the 4th power, or 1 in 1000000000000000000000000. Therefore, it shouldn't have happened, right? And yet, even with those odds, it is nearly assured that 4 people would win.

When something happens the odds of it happening are 1 in 1. There is no "right place" for those mutations to occur. There are only the mutations that did occur. There are nearly an infinite number of species that could have evolved, but only a handful of species did evolve. This is just the same as the millions and millions of losers with just a handful of winners for the lottery. What you are leaving out of your calculations is all of the species that didn't evolve.

By themselves, random base substitutions, and deletions, resulting in beneficial changes to the organism, do not occur frequently enough.

Let's see your math.

As for genetic insertions and recombinations, while occurring fairly often, aren't random processes like mutations, but are functions inherent in the genome.

You need to back up this assertion as well.

Edited by Taq, : No reason given.


This message is a reply to:
 Message 12 by aristotle, posted 06-16-2017 4:19 AM aristotle has not yet responded

  
Taq
Member
Posts: 8488
Joined: 03-06-2009
Member Rating: 7.4


Message 25 of 252 (812466)
06-16-2017 4:52 PM
Reply to: Message 15 by aristotle
06-16-2017 7:01 AM


Aristotle writes:

Again, I ask you how you can ask me to show that mutations were not the cause of our evolution, when you can't prove that they did?

Creationists are the ones claiming that these differences could not be produced by mutations, so I am asking them to prove it.

I don't know how old the earth is, and I'm certainly not as arrogant as evolutionists to think that I know how life was created.

Abiogenesis is not evolution, and the origin of life is not he topic of this thread.


This message is a reply to:
 Message 15 by aristotle, posted 06-16-2017 7:01 AM aristotle has not yet responded

  
Taq
Member
Posts: 8488
Joined: 03-06-2009
Member Rating: 7.4


Message 26 of 252 (812467)
06-16-2017 4:55 PM
Reply to: Message 19 by aristotle
06-16-2017 8:43 AM


Aristotle writes:

The problem is that the 'result' that you claim evolution produces, is always 'pre-specified', because it is incredibly complex and cannot function without all it's parts. Michael Behe in his book 'Darwin's Black Box' states, for example,

How does this apply to the chimp and human genomes? What human features are there that differ from chimps and require multiple parts that are without function except as part of the whole?


This message is a reply to:
 Message 19 by aristotle, posted 06-16-2017 8:43 AM aristotle has not yet responded

  
Taq
Member
Posts: 8488
Joined: 03-06-2009
Member Rating: 7.4


Message 27 of 252 (812468)
06-16-2017 4:56 PM
Reply to: Message 16 by aristotle
06-16-2017 7:09 AM


Aristotle writes:

Noted, but the poster cannot prove that the genetic differences were the produced by ME processes, any more than I can prove they were not.

If you can not prove that these differences were not produced by mutations, then why do creationists claim that they could not be produced by mutations?


This message is a reply to:
 Message 16 by aristotle, posted 06-16-2017 7:09 AM aristotle has not yet responded

  
Taq
Member
Posts: 8488
Joined: 03-06-2009
Member Rating: 7.4


Message 43 of 252 (813416)
06-27-2017 11:24 AM
Reply to: Message 35 by CRR
06-26-2017 7:17 PM


Re: advantageous mutations
CRR writes:

--Many genes would have been linked with genes that are selected and thus would have hitchhiked with them to fixation.
That would actually tend to limit genetic drift to that of actively selected genes. Since ReMine is talking about 1670 beneficial mutations with a much smaller number being in progress at any time this is not going to be significant.

It would tend to drive more beneficial mutations to fixation, which is the whole point. Selective sweeps decrease the cost of natural selection. Much of Haldane's conclusions have been shown to be inaccurate, as Haldane himself anticipated.


This message is a reply to:
 Message 35 by CRR, posted 06-26-2017 7:17 PM CRR has not yet responded

  
Taq
Member
Posts: 8488
Joined: 03-06-2009
Member Rating: 7.4


(1)
Message 68 of 252 (814246)
07-05-2017 11:19 AM
Reply to: Message 50 by mike the wiz
07-02-2017 12:46 PM


mike the wiz writes:

So then evolution claims more than to have just evolved a primate into a primate doesn't it.

In this thread we are just looking at the primate into primate claim.

So for me I would say that the burden of proof isn't upon me to prove micro evolution is an omniscient designer that can come up with the Bombardier beetle, anemone-dart eating sea slugs, Archer fish or humans. I would say the true burden of proof is upon those saying that micro evolution, given enough time, will lead to man from molecules.

That's exactly what the opening post does. From what I can see, humans and chimps evolving from a common ancestor is defined as macroevolution. Going back further in the tree is just a reiteration of the steps that got humans from that common ancestor that is shared with chimps. A difference in two mutations was produced in the same manner as a difference in twelve mutations.

For example if a bacteria becomes resistant, or a fish gets anti-freeze, or a beak is slightly tougher and larger, or a lizard's toe pad slightly differently shaped, does that mean that if we add up those changes they will lead from molecules to man? If they do, you should be able to show a sequential pattern in the micro changes.

Why? Those genomes are long gone and irretrievable.

The problem with that reasoning is that on the MACRO level there are changes that don't have to occur on the MICRO level. For example, all of a planes parts individually, can not fly on the micro level. So then does that mean we can conclude that all the parts together on the macro level, will mean a non-flying plane?

Planes and organisms are not analogous. Planes don't give birth to new planes. Planes don't self assemble, while life does. Planes don't have DNA, while life does.

For me it's reasonable to then say, "then the micro will reveal this macro change" so then show me micro changes which are changing a contraflow lung into a different design of lung, a novel anatomy!

That's not the topic of this thread.

Trying to change the subject is a tacit admission that you find the material in the opening post to be problematic for your argument.


This message is a reply to:
 Message 50 by mike the wiz, posted 07-02-2017 12:46 PM mike the wiz has not yet responded

  
Taq
Member
Posts: 8488
Joined: 03-06-2009
Member Rating: 7.4


(1)
Message 69 of 252 (814247)
07-05-2017 11:27 AM
Reply to: Message 52 by mike the wiz
07-03-2017 5:57 AM


mike the wiz writes:

I wasn't making a point about evolution really, I was making a point about anatomy. For example let us say we have a lung of the bellows type like in humans (rather than the contraflow avian lung), can you see that micro evolution might mean that our lungs "evolve" because of selection pressure, for a demand for a better efficiency.

That's not the topic of this thread.

For me it's tautologous that there was always going to be other species we as humans would be "closest" to anatomically.

We are talking about genetics. At the genetic level, it is not guaranteed that one species would be the closest to humans, at least at a statistically significant level. Let's say that chimps, bonobos, gorillas, and orangutans are in the same kind and evolved from a common ancestor while humans are a separate kind and descend from a separate common ancestor. What would we expect to see when we compared the human genome to that of other apes? What we should see is that humans are genetically equidistant from other ape species. Is that what we see? Nope. What we see is that chimps share more DNA with humans than they do any other ape. This is what we would expect to see if humans evolved from an ape lineage.

So all I am saying is that there is an alternative explanation. I appreciate you don't accept that explanation and are thoroughly convinced of evolution, and I appreciate that you expound that viewpoint with intelligence and clarity, and barely a fallacy in any of your arguments, generally speaking!

The problem is that your explanation is it is falsified by genetics which clearly shows that humans evolved from an ape.


This message is a reply to:
 Message 52 by mike the wiz, posted 07-03-2017 5:57 AM mike the wiz has not yet responded

Replies to this message:
 Message 75 by CRR, posted 07-09-2017 8:11 PM Taq has responded

  
Taq
Member
Posts: 8488
Joined: 03-06-2009
Member Rating: 7.4


Message 70 of 252 (814249)
07-05-2017 11:31 AM
Reply to: Message 60 by mike the wiz
07-03-2017 8:20 AM


mike the wiz writes:

Thirdly we must ask, is it tautologous that, "all evolutionary scientists accept the ToE". Well to be honest I can't really picture too many passionate creationists being evolutionary biologists, I am going to bet that most people that want to become an evolutionary biologist, are already passionate about science.

What we point to is the massive mountains of peer reviewed primary research papers supporting evolution and the tiny, paltry attempts at any type of scientific research on the part of creationists. Remember, science is an activity. Creationists aren't doing any science which is why their claims are not accepted.


This message is a reply to:
 Message 60 by mike the wiz, posted 07-03-2017 8:20 AM mike the wiz has not yet responded

Replies to this message:
 Message 71 by Coyote, posted 07-05-2017 11:38 AM Taq has not yet responded

  
Taq
Member
Posts: 8488
Joined: 03-06-2009
Member Rating: 7.4


(1)
Message 95 of 252 (814530)
07-10-2017 5:14 PM
Reply to: Message 74 by CRR
07-09-2017 7:59 PM


CRR writes:

Microevolutionary events could have produced those two base differences.

If microevolutionary events can produce the differences seen between two kinds, then why do creationists insist that microevolution and macroevolution are different things?


This message is a reply to:
 Message 74 by CRR, posted 07-09-2017 7:59 PM CRR has not yet responded

  
Taq
Member
Posts: 8488
Joined: 03-06-2009
Member Rating: 7.4


(2)
Message 96 of 252 (814532)
07-10-2017 5:18 PM
Reply to: Message 75 by CRR
07-09-2017 8:11 PM


CRR writes:

No, that's not what we should see. Even in the scenario you propose it's quite unlikely that humans are genetically equidistant from the other ape species. Starting from the initial separation the different apes should have drifted closer to or further away as they evolved within the kind.

The probability that an ape species would gain the same mutation that occurs in the human lineage is very, very small. There is a much, much higher probability that they will gain a mutation that humans don't have. Therefore, none of the ape species should be drifting closer to humans. They should all be drifting away from humans at about the same rate since genetic drift is a function of the mutation rate.

When we compare the human genome to any two other species it is almost certain that one of those will be genetically closer to humans than the other. E.g. Human vs dog vs banana. I bet the dog is closer genetically.

That's because dogs and humans share a more recent common ancestor than humans and bananas. This is also why chimps have more DNA in common with humans than orangutans do.

Chickens share the same common ancestor with mice and humans. Guess what? Chickens are equidistant from humans and mice.

Edited by Taq, : No reason given.


This message is a reply to:
 Message 75 by CRR, posted 07-09-2017 8:11 PM CRR has not yet responded

  
Newer Topic | Older Topic
Jump to:


Copyright 2001-2018 by EvC Forum, All Rights Reserved

™ Version 4.0 Beta
Innovative software from Qwixotic © 2021