Understanding through Discussion


Welcome! You are not logged in. [ Login ]
EvC Forum active members: 65 (9077 total)
112 online now:
Minnemooseus (Adminnemooseus) (1 member, 111 visitors)
Newest Member: Contrarian
Post Volume: Total: 894,058 Year: 5,170/6,534 Month: 13/577 Week: 1/80 Day: 1/11 Hour: 0/0


Thread  Details

Email This Thread
Newer Topic | Older Topic
  
Author Topic:   NvC-1: What is the premise of Naturalism in Biology?
Kleinman
Member (Idle past 619 days)
Posts: 528
From: United States
Joined: 10-06-2016


Message 352 of 452 (877340)
06-13-2020 10:38 AM
Reply to: Message 351 by PaulK
06-13-2020 9:26 AM


Re: Mutations can add information
PaulK writes:

While these arguments as I have presented them fall short of proof they still represent a very good reason to think that mutations can add information. Unless they can be overcome it is not at all reasonable to insist that mutations cannot add information.


Information like beauty is in the eye of the beholder.

This message is a reply to:
 Message 351 by PaulK, posted 06-13-2020 9:26 AM PaulK has replied

Replies to this message:
 Message 353 by PaulK, posted 06-13-2020 11:03 AM Kleinman has replied
 Message 356 by AZPaul3, posted 06-13-2020 12:28 PM Kleinman has replied

  
Kleinman
Member (Idle past 619 days)
Posts: 528
From: United States
Joined: 10-06-2016


Message 354 of 452 (877346)
06-13-2020 12:07 PM
Reply to: Message 353 by PaulK
06-13-2020 11:03 AM


Re: Mutations can add information
Kleinman writes:

Information like beauty is in the eye of the beholder.

PaulK writes:

An assertion that does more to undermine Richard Wang’s arguments than mine.


The problem with your argument is that it is vague. You make the statement, "there are two arguments which make a case that mutation [sic] can add information"? What do you mean by "add information" and how do you measure this? Do all mutations add information?

This message is a reply to:
 Message 353 by PaulK, posted 06-13-2020 11:03 AM PaulK has replied

Replies to this message:
 Message 355 by PaulK, posted 06-13-2020 12:25 PM Kleinman has taken no action

  
Kleinman
Member (Idle past 619 days)
Posts: 528
From: United States
Joined: 10-06-2016


Message 357 of 452 (877351)
06-13-2020 1:07 PM
Reply to: Message 356 by AZPaul3
06-13-2020 12:28 PM


Re: Mutations can add information
Kleinman writes:

Information like beauty is in the eye of the beholder.

AZPaul3 writes:

In other words your definition can be whatever you need it to be to fit your pre-conceived conclusion. Such a scientist you are, Richard.


I'm not Richard. So, let's see what your pre-conceived idea of what genetic information is.

AZPaul3 writes:

Nail it down hard.


Do you mean nail it down hard such as you nailed it down hard on the number of replications necessary for a beneficial mutation to occur in the Kishony experiment? You hammered that down to between 1 and infinity. Such a scientist you are.
AZPaul3 writes:

In talking about genetic mutations, “information” is defined as the sequence of nucleobases present in any specific nucleic acid portion.


What information are you seeing there? And what is the difference in the information from one sequence of nucleobases to another?
AZPaul3 writes:

By convention, a human construct, the bases are labeled A, C, T, G in a DNA strand.

As a starting initial sequence a short strand of DNA (double helix) may be represented as:

ATCCATAGCAAAGCGCTTGAGATCCGGTTATACG
GCTTGCGATGGGATATCCAGAGCTTAACCGCGTA

As our example, this sequence of bases, in this specific order, is the information contained in this DNA segment.

By convention, any change in this sequence of bases, by whatever means, is called a “mutation” of the starting initial sequence. *ANY* change to the initial sequence of bases in a DNA segment is a mutation.

As a result, *ANY* mutation is a change in information.

Richard, do you agree with these definitions? If not, where/why would you differ?


Again, I'm not Richard. Your definitions are vague. For example, you say "this sequence of bases, in this specific order, is the information contained in this DNA segment". Are you saying that any sequences of bases has information in it? If so, that's like saying any sequence of letters can make up words, sentences, paragraphs, chapters,... You haven't defined information as it pertains to genetics and how you measure it. So, what information is your eye beholding in these genetic sequences? I think you need a rosetta stone to decipher the information in your genetic hieroglyphics.

This message is a reply to:
 Message 356 by AZPaul3, posted 06-13-2020 12:28 PM AZPaul3 has replied

Replies to this message:
 Message 358 by AZPaul3, posted 06-13-2020 2:52 PM Kleinman has replied

  
Kleinman
Member (Idle past 619 days)
Posts: 528
From: United States
Joined: 10-06-2016


Message 359 of 452 (877354)
06-13-2020 3:33 PM
Reply to: Message 358 by AZPaul3
06-13-2020 2:52 PM


Re: Mutations can add information
Kleinman writes:

You hammered that down to between 1 and infinity. Such a scientist you are.

AZPaul3 writes:

And I was right, despite your self-serving bogus mathematics.


Even Taq was able to hammer that one better than you when he calculated 3e9 replications for each beneficial mutation. How does that serve you?
Kleinman writes:

What information are you seeing there?

AZPaul3 writes:

Dense as a stump.

The information is the sequence of the nucleobases. If you can't understand what that means then take a semester of beginning genetics.


How much information in the sequence? Is that another one with between 1 and infinity? Such a scientist you are. And we marvel at your mathematical skills.
Kleinman writes:

And what is the difference in the information from one sequence of nucleobases to another?

AZPaul3 writes:

The difference in the sequence *is* the difference in the information. You got a real strong handle on this don't ya.


So if the sequence is twice as long, it has between 2 and 2*infinity amount of information? Such a scientist you are.
Kleinman writes:

Are you saying that any sequences of bases has information in it?

AZPaul3 writes:

If you understood how DNA relates to genetics you would know the answer to that question.

Right now we're not relating the information to the chemical operations. We're only establishing that the sequence is the information and that changes to the sequence is mutation.


So, how much does a mutation change the information in a sequence? Is that between 1 and infinity as well? Such a scientist you are.
Kleinman writes:

Again, I'm not Richard.

AZPaul3 writes:

Again my apologies. This message isn't for you. I'll wait for Dr. Wang to respond.


Well, thank you for nailing down for us that genetic information is simply a sequence and it has a value of 1 to infinity. Such a scientist you are.

This message is a reply to:
 Message 358 by AZPaul3, posted 06-13-2020 2:52 PM AZPaul3 has seen this message

  
Kleinman
Member (Idle past 619 days)
Posts: 528
From: United States
Joined: 10-06-2016


Message 364 of 452 (877399)
06-15-2020 1:23 PM
Reply to: Message 361 by Richard L. Wang
06-15-2020 12:42 PM


Re: PaulK(351)&AZPaul3(356): evidence for point mutations producing genetic information
If you don't mind, let me give the Pauls some help. If you correlate biological fitness with information, here's an experimental example of where a mutation increases biological information.
EXTRA MINUTES - SUPERBBUGS (Harvard Experiment explained)
What you are observing is a Markov Chain which is a second law of thermodynamics process. And of course, information and entropy are related.

This message is a reply to:
 Message 361 by Richard L. Wang, posted 06-15-2020 12:42 PM Richard L. Wang has taken no action

  
Kleinman
Member (Idle past 619 days)
Posts: 528
From: United States
Joined: 10-06-2016


Message 368 of 452 (877445)
06-16-2020 11:50 AM
Reply to: Message 367 by Taq
06-16-2020 11:08 AM


Re: Re-PaulK/Taq/AZPaul3: let's change a topic
RLW writes:

So, I suggest we change a topic, for example, mutations,

Taq writes:

Ok. Let's first look at transversion and transition mutations.


Why? You don't understand how this changes the mathematics of DNA evolution. I've given you a link which introduces you to Markov models of DNA evolution:
Models of DNA evolution - Wikipedia
The Jukes-Cantor model assumes the mutation rate for transversions and transitions are equal. The Kimura model takes into account that transversions and transitions have different mutation rates. But there is a fundamental assumption that is made when deriving these models that makes these models incorrect. You should study these models and try to figure out why. Then you might actually understand something about DNA evolution and the mathematics which governs this process.

This message is a reply to:
 Message 367 by Taq, posted 06-16-2020 11:08 AM Taq has replied

Replies to this message:
 Message 369 by Taq, posted 06-16-2020 12:59 PM Kleinman has replied

  
Kleinman
Member (Idle past 619 days)
Posts: 528
From: United States
Joined: 10-06-2016


Message 370 of 452 (877452)
06-16-2020 1:35 PM
Reply to: Message 369 by Taq
06-16-2020 12:59 PM


Re: Re-PaulK/Taq/AZPaul3: let's change a topic
Kleinman writes:

Why? You don't understand how this changes the mathematics of DNA evolution.

Taq writes:

You are wearing out your hobby horse.


You don't even have a horse in this race. You should stick with posting in the "Coffee House" and "Faith and Belief" forums. You certainly don't have the mathematical skills to be posting in the "Is it Science" and "Biological Evolution" forums. If you did have any mathematical skills, you could explain the Jukes-Cantor and Kimura models of DNA evolution and the differences between those two models. And then you could explain how to apply these models to the Kishony Mega-plate experiment. But you don't have those skills.

This message is a reply to:
 Message 369 by Taq, posted 06-16-2020 12:59 PM Taq has replied

Replies to this message:
 Message 371 by Taq, posted 06-16-2020 1:45 PM Kleinman has replied

  
Kleinman
Member (Idle past 619 days)
Posts: 528
From: United States
Joined: 10-06-2016


Message 372 of 452 (877457)
06-16-2020 2:21 PM
Reply to: Message 371 by Taq
06-16-2020 1:45 PM


Re: Re-PaulK/Taq/AZPaul3: let's change a topic
Kleinman writes:

You certainly don't have the mathematical skills to be posting in the "Is it Science" and "Biological Evolution" forums

Taq writes:

So says the person who didn't know what exons and introns are.

If you don't think my posts are worthy of comment then don't respond to them.


If you think your understanding of exons and introns can explain the mathematics of DNA evolution, do it. And if you think your understanding of exons and introns can explain mutations and how they relate to genetic information, do it.

You had a good start with your posts when you calculated 3e9 replication for a beneficial mutation to occur for the Kishony Mega-plate experiment but then you stopped attempting to understand. Instead, you bring up exons and introns which really have nothing to do with DNA evolution and genetic transformation or recombination which is related to genetic transformation (and therefore phenotype) but has little effect on DNA evolution (but you don't know why). But then you stop when I ask you to explain the mathematics of random recombination. Try studying a little harder and learn and understand the mathematics of genetic transformation and what genetic information is all about. You really don't understand this subject as well as you claim you do.


This message is a reply to:
 Message 371 by Taq, posted 06-16-2020 1:45 PM Taq has replied

Replies to this message:
 Message 373 by Taq, posted 06-16-2020 3:41 PM Kleinman has replied

  
Kleinman
Member (Idle past 619 days)
Posts: 528
From: United States
Joined: 10-06-2016


Message 379 of 452 (877471)
06-16-2020 4:40 PM
Reply to: Message 373 by Taq
06-16-2020 3:41 PM


Re: Re-PaulK/Taq/AZPaul3: let's change a topic
Kleinman writes:

If you think your understanding of exons and introns can explain the mathematics of DNA evolution, do it. And if you think your understanding of exons and introns can explain mutations and how they relate to genetic information, do it.

Taq writes:

In case you didn't notice, this isn't a topic on the math of population genetics. One of the signs of a crackpot is that they bring up the same stale topic no matter what the thread is about.


If you understood the subject of population genetics, you would understand how mutations and genetic information is related to this subject. Go back to Message 362 and Message 363 and see that I am right on topic. Instead, you resort to name-calling. I'm presenting empirical and mathematical evidence. You have a superficial understanding of the empirical evidence. You showed that when you computed that it would take 3e9 replications for each beneficial mutation in the Kishony Mega-plate experiment. How does this relate to genetic information? But instead, you are either unwilling or unable to go further. Why won't you attempt to understand this subject?

This message is a reply to:
 Message 373 by Taq, posted 06-16-2020 3:41 PM Taq has replied

Replies to this message:
 Message 380 by Taq, posted 06-16-2020 4:48 PM Kleinman has replied

  
Kleinman
Member (Idle past 619 days)
Posts: 528
From: United States
Joined: 10-06-2016


Message 381 of 452 (877483)
06-16-2020 5:53 PM
Reply to: Message 380 by Taq
06-16-2020 4:48 PM


Re: Re-PaulK/Taq/AZPaul3: let's change a topic
Kleinman writes:

I'm presenting empirical and mathematical evidence.

Taq writes:

Evidence of what? What point are you trying to make? Do you have something other than insulting people while demanding that they do math problems?


The empirical evidence starts with the Kishony and Lenski experiments. And you started scratching the surface on the math with your calculation of 3e9 replication for each evolutionary step in the Kishony experiment. I already know how to do the math. If you can't do the math and you find that insulting, learn how to do the math.
Kleinman writes:

How does this relate to genetic information?

Taq writes:

You tell us. Get to the point.


Genetic information has to be measured in the context of the environment. So, consider the Kishony experiment. What mutations give increased information (fitness) for that environment? And what is the rate of accumulation of that information? That is your Markov chain calculation. And if you know how to do that calculation, you will understand how DNA evolution works and how it relates to genetic information. Didn't they teach you any of this in your biology class?

This message is a reply to:
 Message 380 by Taq, posted 06-16-2020 4:48 PM Taq has replied

Replies to this message:
 Message 382 by Taq, posted 06-16-2020 5:56 PM Kleinman has replied

  
Kleinman
Member (Idle past 619 days)
Posts: 528
From: United States
Joined: 10-06-2016


Message 383 of 452 (877487)
06-16-2020 6:28 PM
Reply to: Message 382 by Taq
06-16-2020 5:56 PM


Re: Re-PaulK/Taq/AZPaul3: let's change a topic
Kleinman writes:

The empirical evidence starts with the Kishony and Lenski experiments.

Taq writes:

Ok. Keep going.

Kleinman writes:

Genetic information has to be measured in the context of the environment. So, consider the Kishony experiment. What mutations give increased information (fitness) for that environment? And what is the rate of accumulation of that information? That is your Markov chain calculation. And if you know how to do that calculation, you will understand how DNA evolution works and how it relates to genetic information.

Taq writes:

Then how does DNA evolution work and how does it relate to genetic information? Spit it out.


I'll say it again and as many times as necessary for you to get it. DNA evolution is a Markov Chain process. From the way you are posting, it appears you have no idea what a Markov Chain process is. Here's a simple introductory video to learn how you do a Markov Chain calculation. This is part 1, it wouldn't hurt for you to watch all three parts.
Markov Chains - Part 1

This message is a reply to:
 Message 382 by Taq, posted 06-16-2020 5:56 PM Taq has replied

Replies to this message:
 Message 384 by Taq, posted 06-16-2020 6:41 PM Kleinman has replied

  
Kleinman
Member (Idle past 619 days)
Posts: 528
From: United States
Joined: 10-06-2016


Message 386 of 452 (877518)
06-17-2020 9:50 AM
Reply to: Message 384 by Taq
06-16-2020 6:41 PM


Re: Re-PaulK/Taq/AZPaul3: let's change a topic
Kleinman writes:

DNA evolution is a Markov Chain process.

Taq writes:

So how does that relate to information in genetics, and how does it relate to the role of naturalism in biology?


To understand this, you first need to recognize that DNA evolution is a stochastic process (mutations occur randomly). Then, from this link:
Entropy rate - Wikipedia
"In the mathematical theory of probability, the entropy rate or source information rate of a stochastic process is, informally, the time density of the average information in a stochastic process.

Since a stochastic process defined by a Markov chain that is irreducible, aperiodic and positive recurrent has a stationary distribution, the entropy rate is independent of the initial distribution."
Then, further down in this link, they show you how to compute this value for a Markov chain process:
"For example, for such a Markov chain... (equations from link which don't format correctly here) is the asymptotic distribution of the chain.

A simple consequence of this definition is that an i.i.d. stochastic process has an entropy rate that is the same as the entropy of any individual member of the process."

The problem with trying to apply this equation directly to actual evolutionary examples such as the Kishony and Lenski experiments (and really all examples of evolution) is that these real DNA evolutionary processes are not stationary, that is they don't go to equilibrium. At equilibrium, the distribution of bases at any site in a population no longer changes. If you look at the Markov DNA evolution models from this link:
Models of DNA evolution - Wikipedia
You will find that these models (e.g. Jukes-Cantor, Kimura) are stationary models. That is, after some period of time, the frequencies of A, C, G, and T all go to 0.25. That is 1/4 of the population will have an A base at the given site, 1/4 of the population will have a C base at the given site and likewise for the G and T bases. The Kishony and Lenski experiments get nowhere close to that distribution. What that means is that the transition matrix they are using is incorrect and that real DNA evolutionary process gets nowhere close to equilibrium.

If you want to learn how information and entropy are related, get a copy of the following text:
Equilibrium Statistical Mechanics: Andrews, Frank C.: 9780471031239: Amazon.com: Books
Andrews has a chapter in this book where he derives Shannon's information equation from the Boltzmann's entropy formula.

The way this relates to naturalism is to do your naturalism correctly. Learn how to correlate your math to reality, not to some vision you have. Darwin recognized what the two fundamental phenomena of evolution were, what he called the struggle for existence (and what we call competition), and adaptation (what we call DNA evolution). What Darwin didn't do is quantify these phenomena. As a naturalist, you should want to quantify these concepts correctly because then you can correctly predict things such as the evolution of drug-resistance or the failure of cancer treatments.


This message is a reply to:
 Message 384 by Taq, posted 06-16-2020 6:41 PM Taq has replied

Replies to this message:
 Message 387 by Taq, posted 06-17-2020 11:59 AM Kleinman has replied

  
Kleinman
Member (Idle past 619 days)
Posts: 528
From: United States
Joined: 10-06-2016


Message 388 of 452 (877527)
06-17-2020 12:42 PM
Reply to: Message 387 by Taq
06-17-2020 11:59 AM


Re: Re-PaulK/Taq/AZPaul3: let's change a topic
Kleinman writes:

The way this relates to naturalism is to do your naturalism correctly.

Taq writes:

That was assumed from the very start of this thread. Is that all you have as it relates to the topic?


Yep, the correct way to do the naturalism of DNA evolution. You should learn how to do it.

This message is a reply to:
 Message 387 by Taq, posted 06-17-2020 11:59 AM Taq has replied

Replies to this message:
 Message 389 by Taq, posted 06-17-2020 1:12 PM Kleinman has replied

  
Kleinman
Member (Idle past 619 days)
Posts: 528
From: United States
Joined: 10-06-2016


Message 390 of 452 (877530)
06-17-2020 1:26 PM
Reply to: Message 389 by Taq
06-17-2020 1:12 PM


Re: Re-PaulK/Taq/AZPaul3: let's change a topic
Kleinman writes:

You should learn how to do it.

Taq writes:

So you would agree that biology can be understood in terms of naturalism?


Yes, but only if you do the mathematics correctly and the link you posted, they don't do the mathematics correctly. And you don't know why.

This message is a reply to:
 Message 389 by Taq, posted 06-17-2020 1:12 PM Taq has taken no action

  
Kleinman
Member (Idle past 619 days)
Posts: 528
From: United States
Joined: 10-06-2016


Message 436 of 452 (879530)
07-17-2020 12:29 PM
Reply to: Message 435 by Richard L. Wang
07-17-2020 12:08 PM


Re: Re-AZPaul3(433): reply straightforwardly, please
Richard L. Wang writes:

As I wrote in RLW(Message 429), this shows again that you have lost the debate on whether Darwinian-Naturalism is pseudoscience.


Actually, Darwinian evolution is qualitatively correct. It's when you quantitate his theory that you run into problems.

This message is a reply to:
 Message 435 by Richard L. Wang, posted 07-17-2020 12:08 PM Richard L. Wang has taken no action

  
Newer Topic | Older Topic
Jump to:


Copyright 2001-2018 by EvC Forum, All Rights Reserved

™ Version 4.1
Innovative software from Qwixotic © 2022