Understanding through Discussion


Welcome! You are not logged in. [ Login ]
EvC Forum active members: 85 (8984 total)
38 online now:
DrJones*, PaulK (2 members, 36 visitors)
Newest Member: Jerry Johnson
Upcoming Birthdays: Diomedes
Post Volume: Total: 877,570 Year: 9,318/23,288 Month: 333/1,544 Week: 47/561 Day: 0/47 Hour: 0/0


Thread  Details

Email This Thread
Newer Topic | Older Topic
  
Author Topic:   NvC-1: What is the premise of Naturalism in Biology?
AZPaul3
Member
Posts: 5118
From: Phoenix
Joined: 11-06-2006
Member Rating: 3.1


Message 346 of 429 (877314)
06-11-2020 5:43 PM
Reply to: Message 341 by Richard L. Wang
06-11-2020 4:34 PM


Re: Re-PaulK(338): Logic is a powerful tool in science
... this is not a chemical or physical process, but an information process. There is no need to discover the detail of how the mind operates, people can make the judgement ...

In other words, the reality of the full process does not matter when that level of detail counters my concerted attempt to fell natural processes in favor of the anti-science woo that underpins my faith in my blood thirsty sky daddy.


Factio Republicana delenda est.
I am antifa.

This message is a reply to:
 Message 341 by Richard L. Wang, posted 06-11-2020 4:34 PM Richard L. Wang has responded

Replies to this message:
 Message 347 by Richard L. Wang, posted 06-12-2020 3:55 PM AZPaul3 has responded

  
Richard L. Wang
Member
Posts: 94
From: Ottawa, ON, Canada
Joined: 04-27-2020


Message 347 of 429 (877325)
06-12-2020 3:55 PM
Reply to: Message 346 by AZPaul3
06-11-2020 5:43 PM


Re-PaulK/Taq/AZPaul3: let's change a topic
Half a month after I submitted the message RLW(Message 263) on May 27 that “Bioinformatic processes don’t obey the natural laws”, we’ve posted over 80 messages. I have put all my cards on the table, and you guys still insist that only natural laws play a role in the world. So, I suggest we change a topic, for example, mutations, which PaulK raised ten days ago in PaulK(Message 307).

This message is a reply to:
 Message 346 by AZPaul3, posted 06-11-2020 5:43 PM AZPaul3 has responded

Replies to this message:
 Message 348 by PaulK, posted 06-12-2020 4:02 PM Richard L. Wang has not yet responded
 Message 349 by Tangle, posted 06-12-2020 4:52 PM Richard L. Wang has not yet responded
 Message 350 by AZPaul3, posted 06-12-2020 8:42 PM Richard L. Wang has not yet responded
 Message 351 by PaulK, posted 06-13-2020 9:26 AM Richard L. Wang has responded
 Message 367 by Taq, posted 06-16-2020 11:08 AM Richard L. Wang has not yet responded

  
PaulK
Member
Posts: 16316
Joined: 01-10-2003
Member Rating: 1.7


Message 348 of 429 (877326)
06-12-2020 4:02 PM
Reply to: Message 347 by Richard L. Wang
06-12-2020 3:55 PM


Re: Re-PaulK/Taq/AZPaul3: let's change a topic
Eighty messages in which you have produced no real evidence of bioinformatic processes violating natural law. So what do you expect? That we should just accept your opinion? That certainly isn’t how it works in science.

But yes, let’s discuss how mutations change and add information, since that would be an actually relevant discussion.


This message is a reply to:
 Message 347 by Richard L. Wang, posted 06-12-2020 3:55 PM Richard L. Wang has not yet responded

  
Tangle
Member
Posts: 7710
From: UK
Joined: 10-07-2011
Member Rating: 2.8


Message 349 of 429 (877328)
06-12-2020 4:52 PM
Reply to: Message 347 by Richard L. Wang
06-12-2020 3:55 PM


Re: Re-PaulK/Taq/AZPaul3: let's change a topic
RLW writes:

Half a month after I submitted the message RLW(Message 263) on May 27 that “Bioinformatic processes don’t obey the natural laws”, we’ve posted over 80 messages. I have put all my cards on the table, and you guys still insist that only natural laws play a role in the world.

I've not seen anything at all from you that doesn't obey natural laws and you've refused to own up to your sub agenda that whatever you declare as 'not following natural laws' is therefore following supernatural laws.

So how about you actually putting your cards on the table And admitting it. Are you shy? The cock has crowed.


Je suis Charlie. Je suis Ahmed. Je suis Juif. Je suis Parisien. I am Mancunian. I am Brum. I am London.I am Finland. Soy Barcelona

"Life, don't talk to me about life" - Marvin the Paranoid Android

"Science adjusts it's views based on what's observed.
Faith is the denial of observation so that Belief can be preserved."
- Tim Minchin, in his beat poem, Storm.


This message is a reply to:
 Message 347 by Richard L. Wang, posted 06-12-2020 3:55 PM Richard L. Wang has not yet responded

  
AZPaul3
Member
Posts: 5118
From: Phoenix
Joined: 11-06-2006
Member Rating: 3.1


Message 350 of 429 (877330)
06-12-2020 8:42 PM
Reply to: Message 347 by Richard L. Wang
06-12-2020 3:55 PM


On to the Mutations!
we’ve posted over 80 messages. I have put all my cards on the table, and you guys still insist that only natural laws play a role in the world.

That should tell you two things. First, your presentations toward your non-natural woo-woo processes have not been compelling enough to be given serious consideration. Second, that your contention that anything other than natural processes operating in this universe may be wrong.

I suggest we change a topic, for example, mutations...

If you must. Just keep in mind that any processes you may suggest that do not adhere to strictly natural processes and functions will require the most compelling evidence be presented. Something no one else in this decades long debate has ever been able to do. Good luck.

Edited by AZPaul3, : No reason given.


Factio Republicana delenda est.
I am antifa.

This message is a reply to:
 Message 347 by Richard L. Wang, posted 06-12-2020 3:55 PM Richard L. Wang has not yet responded

  
PaulK
Member
Posts: 16316
Joined: 01-10-2003
Member Rating: 1.7


Message 351 of 429 (877339)
06-13-2020 9:26 AM
Reply to: Message 347 by Richard L. Wang
06-12-2020 3:55 PM


Mutations can add information
In the context of reproductive biology, the information in a DNA molecule is entirely determined by the sequence of bases. Thus, changes to the information - including additions - must be changes to that sequence.

Mutations do change that sequence, adding to it, removing from it, changing bases and even swapping one part of the sequence to another.

Creationists have tried to argue that mutations cannot add information, but those arguments generally founder on the lack of a suitable measure of information. Typically no measure is given, but even when one is showing that it is relevant and actually applying it properly are serious difficulties.

I believe, however, that there are two arguments which make a case that mutation can add information.

The first relies on the simple fact that point mutations - the replacement of one base with another - are reversible - any change made by one such mutation can be done by another. Unless we assume that all sequences of a given length have the same amount of information then point mutations can change the information content - and if any mutation causes a loss the reverse mutation must cause a gain of information.

The second relies on multiple mutations. The addition of a new, distinct gene to a genome - differing from the other genes, at least slightly - is surely a gain of information. Certainly it is if the protein that the gene codes for is produced and is useful to the organism. Mutation can and does do this, although it takes multiple steps. First an existing gene is duplicated, then - in some cases - subsequent mutations change one of the copies, making it distinct. With the aid of selection that version can become adapted to a particular use - which may or may not have been served by the original gene. For instance a gene involved in blood clotting could evolve to produce a venom. This is called “duplication and diversification”

While these arguments as I have presented them fall short of proof they still represent a very good reason to think that mutations can add information. Unless they can be overcome it is not at all reasonable to insist that mutations cannot add information.


This message is a reply to:
 Message 347 by Richard L. Wang, posted 06-12-2020 3:55 PM Richard L. Wang has responded

Replies to this message:
 Message 352 by Kleinman, posted 06-13-2020 10:38 AM PaulK has responded
 Message 360 by Richard L. Wang, posted 06-15-2020 12:37 PM PaulK has responded

  
Kleinman
Member
Posts: 386
From: United States
Joined: 10-06-2016
Member Rating: 1.1


Message 352 of 429 (877340)
06-13-2020 10:38 AM
Reply to: Message 351 by PaulK
06-13-2020 9:26 AM


Re: Mutations can add information
PaulK writes:

While these arguments as I have presented them fall short of proof they still represent a very good reason to think that mutations can add information. Unless they can be overcome it is not at all reasonable to insist that mutations cannot add information.


Information like beauty is in the eye of the beholder.

This message is a reply to:
 Message 351 by PaulK, posted 06-13-2020 9:26 AM PaulK has responded

Replies to this message:
 Message 353 by PaulK, posted 06-13-2020 11:03 AM Kleinman has responded
 Message 356 by AZPaul3, posted 06-13-2020 12:28 PM Kleinman has responded

  
PaulK
Member
Posts: 16316
Joined: 01-10-2003
Member Rating: 1.7


Message 353 of 429 (877344)
06-13-2020 11:03 AM
Reply to: Message 352 by Kleinman
06-13-2020 10:38 AM


Re: Mutations can add information
quote:
Information like beauty is in the eye of the beholder.

An assertion that does more to undermine Richard Wang’s arguments than mine.


This message is a reply to:
 Message 352 by Kleinman, posted 06-13-2020 10:38 AM Kleinman has responded

Replies to this message:
 Message 354 by Kleinman, posted 06-13-2020 12:07 PM PaulK has responded

  
Kleinman
Member
Posts: 386
From: United States
Joined: 10-06-2016
Member Rating: 1.1


Message 354 of 429 (877346)
06-13-2020 12:07 PM
Reply to: Message 353 by PaulK
06-13-2020 11:03 AM


Re: Mutations can add information
Kleinman writes:

Information like beauty is in the eye of the beholder.

PaulK writes:

An assertion that does more to undermine Richard Wang’s arguments than mine.


The problem with your argument is that it is vague. You make the statement, "there are two arguments which make a case that mutation [sic] can add information"? What do you mean by "add information" and how do you measure this? Do all mutations add information?

This message is a reply to:
 Message 353 by PaulK, posted 06-13-2020 11:03 AM PaulK has responded

Replies to this message:
 Message 355 by PaulK, posted 06-13-2020 12:25 PM Kleinman has not yet responded

  
PaulK
Member
Posts: 16316
Joined: 01-10-2003
Member Rating: 1.7


Message 355 of 429 (877347)
06-13-2020 12:25 PM
Reply to: Message 354 by Kleinman
06-13-2020 12:07 PM


Re: Mutations can add information
quote:
The problem with your argument is that it is vague

It isn’t at all - if you accept the idea that DNA contains information relevant to the construction of the phenotype. And if you recognise that this is in the context of Richard Wang claiming that material processes cannot add information and that this is a prob,em for evolution.

quote:
What do you mean by "add information" and how do you measure this?

The first argument is constructed to avoid any need to define it further. It is only necessary to accept that a point mutation can change the amount of information in the DNA. A refusal to accept that point will lead to serious problems for any evolutionary argument.

The second argument appeals to the intuitive point that two useful genes with differing sequences will contain more information than either one on their own. There is no need for further measurement if that is accepted - and refusing to accept it is both counter-intuitive and likely to cause problems for the opposing argument.

quote:
Do all mutations add information?

This shows that the problem is in the reader, not the text since the first argument makes it clear that if an increase is possible then a decrease is also possible,


This message is a reply to:
 Message 354 by Kleinman, posted 06-13-2020 12:07 PM Kleinman has not yet responded

  
AZPaul3
Member
Posts: 5118
From: Phoenix
Joined: 11-06-2006
Member Rating: 3.1


Message 356 of 429 (877348)
06-13-2020 12:28 PM
Reply to: Message 352 by Kleinman
06-13-2020 10:38 AM


Re: Mutations can add information
Information like beauty is in the eye of the beholder.

In other words your definition can be whatever you need it to be to fit your pre-conceived conclusion. Such a scientist you are, Richard.

Nail it down hard.

In talking about genetic mutations, “information” is defined as the sequence of nucleobases present in any specific nucleic acid portion.

By convention, a human construct, the bases are labeled A, C, T, G in a DNA strand.

As a starting initial sequence a short strand of DNA (double helix) may be represented as:

ATCCATAGCAAAGCGCTTGAGATCCGGTTATACG
GCTTGCGATGGGATATCCAGAGCTTAACCGCGTA

As our example, this sequence of bases, in this specific order, is the information contained in this DNA segment.

By convention, any change in this sequence of bases, by whatever means, is called a “mutation” of the starting initial sequence. *ANY* change to the initial sequence of bases in a DNA segment is a mutation.

As a result, *ANY* mutation is a change in information.

Richard, do you agree with these definitions? If not, where/why would you differ?


Factio Republicana delenda est.
I am antifa.

This message is a reply to:
 Message 352 by Kleinman, posted 06-13-2020 10:38 AM Kleinman has responded

Replies to this message:
 Message 357 by Kleinman, posted 06-13-2020 1:07 PM AZPaul3 has responded
 Message 361 by Richard L. Wang, posted 06-15-2020 12:42 PM AZPaul3 has not yet responded

  
Kleinman
Member
Posts: 386
From: United States
Joined: 10-06-2016
Member Rating: 1.1


Message 357 of 429 (877351)
06-13-2020 1:07 PM
Reply to: Message 356 by AZPaul3
06-13-2020 12:28 PM


Re: Mutations can add information
Kleinman writes:

Information like beauty is in the eye of the beholder.

AZPaul3 writes:

In other words your definition can be whatever you need it to be to fit your pre-conceived conclusion. Such a scientist you are, Richard.


I'm not Richard. So, let's see what your pre-conceived idea of what genetic information is.

AZPaul3 writes:

Nail it down hard.


Do you mean nail it down hard such as you nailed it down hard on the number of replications necessary for a beneficial mutation to occur in the Kishony experiment? You hammered that down to between 1 and infinity. Such a scientist you are.
AZPaul3 writes:

In talking about genetic mutations, “information” is defined as the sequence of nucleobases present in any specific nucleic acid portion.


What information are you seeing there? And what is the difference in the information from one sequence of nucleobases to another?
AZPaul3 writes:

By convention, a human construct, the bases are labeled A, C, T, G in a DNA strand.

As a starting initial sequence a short strand of DNA (double helix) may be represented as:

ATCCATAGCAAAGCGCTTGAGATCCGGTTATACG
GCTTGCGATGGGATATCCAGAGCTTAACCGCGTA

As our example, this sequence of bases, in this specific order, is the information contained in this DNA segment.

By convention, any change in this sequence of bases, by whatever means, is called a “mutation” of the starting initial sequence. *ANY* change to the initial sequence of bases in a DNA segment is a mutation.

As a result, *ANY* mutation is a change in information.

Richard, do you agree with these definitions? If not, where/why would you differ?


Again, I'm not Richard. Your definitions are vague. For example, you say "this sequence of bases, in this specific order, is the information contained in this DNA segment". Are you saying that any sequences of bases has information in it? If so, that's like saying any sequence of letters can make up words, sentences, paragraphs, chapters,... You haven't defined information as it pertains to genetics and how you measure it. So, what information is your eye beholding in these genetic sequences? I think you need a rosetta stone to decipher the information in your genetic hieroglyphics.

This message is a reply to:
 Message 356 by AZPaul3, posted 06-13-2020 12:28 PM AZPaul3 has responded

Replies to this message:
 Message 358 by AZPaul3, posted 06-13-2020 2:52 PM Kleinman has responded

  
AZPaul3
Member
Posts: 5118
From: Phoenix
Joined: 11-06-2006
Member Rating: 3.1


Message 358 of 429 (877353)
06-13-2020 2:52 PM
Reply to: Message 357 by Kleinman
06-13-2020 1:07 PM


Re: Mutations can add information
I'm not Richard.

My apologies.

You hammered that down to between 1 and infinity. Such a scientist you are.

And I was right, despite your self-serving bogus mathematics.

What information are you seeing there?

Dense as a stump.

The information is the sequence of the nucleobases. If you can't understand what that means then take a semester of beginning genetics.

And what is the difference in the information from one sequence of nucleobases to another?

The difference in the sequence *is* the difference in the information. You got a real strong handle on this don't ya.

Are you saying that any sequences of bases has information in it?

If you understood how DNA relates to genetics you would know the answer to that question.

Right now we're not relating the information to the chemical operations. We're only establishing that the sequence is the information and that changes to the sequence is mutation.

Again, I'm not Richard.

Again my apologies. This message isn't for you. I'll wait for Dr. Wang to respond.


Factio Republicana delenda est.
I am antifa.

This message is a reply to:
 Message 357 by Kleinman, posted 06-13-2020 1:07 PM Kleinman has responded

Replies to this message:
 Message 359 by Kleinman, posted 06-13-2020 3:33 PM AZPaul3 has not yet responded

  
Kleinman
Member
Posts: 386
From: United States
Joined: 10-06-2016
Member Rating: 1.1


Message 359 of 429 (877354)
06-13-2020 3:33 PM
Reply to: Message 358 by AZPaul3
06-13-2020 2:52 PM


Re: Mutations can add information
Kleinman writes:

You hammered that down to between 1 and infinity. Such a scientist you are.

AZPaul3 writes:

And I was right, despite your self-serving bogus mathematics.


Even Taq was able to hammer that one better than you when he calculated 3e9 replications for each beneficial mutation. How does that serve you?
Kleinman writes:

What information are you seeing there?

AZPaul3 writes:

Dense as a stump.

The information is the sequence of the nucleobases. If you can't understand what that means then take a semester of beginning genetics.


How much information in the sequence? Is that another one with between 1 and infinity? Such a scientist you are. And we marvel at your mathematical skills.
Kleinman writes:

And what is the difference in the information from one sequence of nucleobases to another?

AZPaul3 writes:

The difference in the sequence *is* the difference in the information. You got a real strong handle on this don't ya.


So if the sequence is twice as long, it has between 2 and 2*infinity amount of information? Such a scientist you are.
Kleinman writes:

Are you saying that any sequences of bases has information in it?

AZPaul3 writes:

If you understood how DNA relates to genetics you would know the answer to that question.

Right now we're not relating the information to the chemical operations. We're only establishing that the sequence is the information and that changes to the sequence is mutation.


So, how much does a mutation change the information in a sequence? Is that between 1 and infinity as well? Such a scientist you are.
Kleinman writes:

Again, I'm not Richard.

AZPaul3 writes:

Again my apologies. This message isn't for you. I'll wait for Dr. Wang to respond.


Well, thank you for nailing down for us that genetic information is simply a sequence and it has a value of 1 to infinity. Such a scientist you are.

This message is a reply to:
 Message 358 by AZPaul3, posted 06-13-2020 2:52 PM AZPaul3 has not yet responded

  
Richard L. Wang
Member
Posts: 94
From: Ottawa, ON, Canada
Joined: 04-27-2020


Message 360 of 429 (877395)
06-15-2020 12:37 PM
Reply to: Message 351 by PaulK
06-13-2020 9:26 AM


PaulK, show evidence for mutations occur by natural law
Richard is here.

As PaulK(Message 307) wrote

quote:
Mutations occur by natural law, ...

How do you know it? What is the evidence to support your assertion?


This message is a reply to:
 Message 351 by PaulK, posted 06-13-2020 9:26 AM PaulK has responded

Replies to this message:
 Message 362 by PaulK, posted 06-15-2020 1:01 PM Richard L. Wang has responded

  
Newer Topic | Older Topic
Jump to:


Copyright 2001-2018 by EvC Forum, All Rights Reserved

™ Version 4.0 Beta
Innovative software from Qwixotic © 2020