Fact Theory Falacy

And how can you prove ID in the same way you can 1+1=2. If you can't it's not a valid comparison.------------------
Occam's razor is not for shaving with.

To add to Joz',HIV RNA mutates over a million times faster than human DNA. It is (& has been) possible to construct "evolutionary trees" of HIV strains in a SINGLE PERSON. ie, If you've had it long enough, you're privy to your own personal strains of the virus.It is possible, because of this rapid mutation rate to examine HIV RNA & construct a tree of who infected who. This also has been done, where an outbreak was extrapolated back to a single dentist, by looking at who MUST HAVE infected who (regardless of what those people said!).This is the power of genetically derived phylogenies.The methods can happily save lives Mark------------------
Occam's razor is not for shaving with.

Not sure what you're driving at TC, perhaps a definition of new information is in order?Mark------------------
Occam's razor is not for shaving with.

​

[This message has been edited by mark24, 02-08-2002]

quote:

---

Originally posted by TrueCreation:
"Not sure what you're driving at TC, perhaps a definition of new information is in order?"

​

AGGTCTCAACTAGTCTGGAGGCTGA

​

And By mutational effects get this:

​

|-New information-|

​

AGGTCTCAACT|-CTAG-|TGGA|-AGT-|TGA|-AGTAACTACCTGTG-|

​

--See above, I gave examples on what new information would be as a string of bases, this is what new information is to my knoweldge that 'E'volution needs.

​

---

That is correct, you have nucleotide substitutions & insertions, both are known mutation types. Giving a changed, & longer sequence.So, do we agree new information is possible as a result of mutations, then?Mark------------------
Occam's razor is not for shaving with.

quote:

---

Originally posted by TrueCreation:
I can't find where it makes relevance to something new observably coming about, could you point it out to me? It seems they are talking of how they could have come about from a previous ancestor, not giving an example of this new information coming about.

​

---

You provided an example that would mean that new information had been presented.I concur, whether it codes for anything useful is irrelevant to your example. It was a standard set by YOU, not me or Joz. The point is it COULD.Joz has provided you with an example of entire genes being duplicated, mutating, & being useful, to his example I would add myoglobin, that stores oxygen in muscle tissue.Is there an example of point mutations creating new functional protein?Yes. http://www.nmsr.org/nylon.htmMy favorite example of a mutation producing new information involves a Japanese bacterium that suffered a frame shift mutation that just happened to allow it to metabolize nylon waste. The new enzymes are very inefficient (having only 2% of the efficiency of the regular enzymes), but do afford the bacteria a whole new ecological niche. They don't work at all on the bacterium's original food - carbohydrates. And this type of mutation has even happened more than once!Mark------------------
Occam's razor is not for shaving with.

​

[This message has been edited by mark24, 02-08-2002]

quote:

---

Originally posted by TrueCreation:

"Is there an example of point mutations creating new functional protein?

​

Yes.

​

http://www.nmsr.org/nylon.htm

​

My favorite example of a mutation producing new information involves a Japanese bacterium that suffered a frame shift mutation that just happened to allow it to metabolize nylon waste. The new enzymes are very inefficient (having only 2% of the efficiency of the regular enzymes), but do afford the bacteria a whole new ecological niche. They don't work at all on the bacterium's original food - carbohydrates. And this type of mutation has even happened more than once!"

​

--I found the article very interesting, I also found this, I quote form an AiG rebutal towards an e-mail they received regarding nylon digesting bacterium:

​

AiG - That depends on what your definition of information is - http://www.answersingenesis.org/home/area/feedback/negative7-24-2000.asp

​

---

But, again, there is no definition of what information is, let alone new information.TC, you have already given me the requirements that genetic information would need to display to exhibit new information, I have shown that it does occur by mutation, by your definition. You cannot now move the goalposts by defining information differently. What is the point of a discussion, when the person who has his definition of new information proven, then cries "that's not the correct definition!".I have asked many times for creationists to define "new information", now you know why they don't, because that definition could show new information, as a result of mutation. At least you had the balls to try . [QUOTE]Originally posted by TrueCreation:
[b]
Finally, Mr Cerutti is out of date about this new nylon digesting ability allegedly from a frame shift. New evidence shows that the ability was due to plasmids /b][/QUOTE]New evidence shows that the ability was due to plasmids is like saying digestion of starch is due to chromosomes.What this shows is an example of not understanding the issue in hand. What is being inferred is that the gene was gained from another bacteria, via interspecial recombination, which does occur. However, the ORIGINAL carbohydrate gene has been sequenced, as has the new nylon one This shows the addition of a Thymine nucleotide, causing frame shift. No amount of wriggling will get away from this, it is a repeatable experiment. I repeat, the only difference in over 400 nucleotides is a single thymine addition.Now, back to new information. The problem I have with creationist definitions of the above, is that they deliberately try to be so narrow, so as to exclude new functional proteins as being derived from new information. For example, when I asked for a definition of new information, I got this :A new codon instruction that performs some function intended by the sender. For example, if a new codon arose that caused DNA transcription to jump to some other specific part of the genome to perform a useful function (a ‘JUMP’ codon),Can you not see our frustration? Does this definition allow new information to be gleaned by a book? Morse code? Pictures? No, it’s ridiculously narrow a definition. A simple, all encompassing definition is all we want. Then, armed with this, we can check definitions of new information that exist at different levels of information. ie What is & isn’t new information in a genetic context, but I want a general definition first.Mark------------------
Occam's razor is not for shaving with.

quote:

---

Originally posted by joz:
Good answer Mark but I think the important criticism of their plasmids is that even if the ability was gained from other bacteria why the hell do those bacteria have the ability to digest a synthetc material that has only existed for 50 some years?

---

Thanks Joz, & I agree, but you expose a hole in my knowledge, that I really should have closed ages ago.Do asexual bacteria have multiple alleles like sexually reproducing organisms? My initial answer would be no, there is no recombination to "sort" them out, there would be no point.This means there is only one allele per gene (if that makes sense), & any mutation cannot destroy function, because the only gene would be wrecked. Whereas, in a sexual organism, if that allele was one of many, it would become a pseudogene.Anyone?Thanks,Mark

quote:

---

Originally posted by TrueCreation:

"What this shows is an example of not understanding the issue in hand. What is being inferred is that the gene was gained from another bacteria, via interspecial recombination, which does occur."

​

--So the gene was taken from another bacteria?

​

---

In this case, no. Flavobacterium "carbohydrate" gene still exists in other Flavobacterium, the mutated strain differs in the "carbohydrate" gene being a "nylon" gene instead.In other bacteria, functional genes can be gained by recombination with different species. Some anti-biotic resisant bacteria naturally have a gene that produces a protein that attaches itself to the penicillin protein, neutralising it. This gene has since turned up in bacterial species that previously never had it (such as tuberculosis), making them resistant too. If you read Fred's article in "Reproductive Cost problem more devastating than ever " thread, he maintains that asexually producing organisms to not exhibit recombination. This is patently wrong. It may not be as important as in sexually reproducing organisms, but it is going to stop a lot of bacteria suffering the same fate as smallpox, which now only exists in a few laboratories.Mark------------------
Occam's razor is not for shaving with.

quote:

---

Originally posted by KingPenguin:
sweet, science in action i love it. lets just pray it doesnt eat up all the oil on the planet, i cannot imagine what that would cause.

​

---

I can't imagine how they would survive the pressure, or get that far underground, through solid, non-porous rock!Another related example of science in action, is the synthesis if human insulin in bacteria (for the benefit of diabetics). The human insulin gene is inserted into the bacterial plasmid, which is reproduced as the bacteria reproduces. The new organism dutifully produces insulin from this recombinant DNA.Mark------------------
Occam's razor is not for shaving with.

How do you get something down a deep pipe that only pumps up?------------------
Occam's razor is not for shaving with.

well, maybe you got an industrial espoionage idea! ------------------
Occam's razor is not for shaving with.

quote:

---

Originally posted by KingPenguin:
thank you so much heh, but can chains get longer and more diverse? meaning can new amino acids be added or completely removed rather than just being made dormant?

​

---

YesFirstly, how does an amino acid become dormant?Secondly, from this very thread. http://www.nmsr.org/nylon.htm"Now, let's get back to Biology, and the case of the bacterium which has evolved the capability of ingesting nylon waste. This case is most interesting. Nylon didn't exist before 1937, and neither did this organism. Detailed examination of the DNA sequences of the original bacterium and of the nylon-ingesting version show identical versions in the gene for a key metabolic enzyme, with only one difference in over 400 nucleotides. However, this single microevolutionary addition of a single thymine ('T') nucleotide caused the new bacterium's enzyme to be composed of a completely novel sequence of amino acids, via the mechanism of frame shifting. The new enzyme is 50 times less efficient than its precursor, as would be expected for a new structure which has not had time to be polished by natural selection. However, this inefficiency would certainly not be expected in the work of an intelligent designer. The genetic mutation that produced this particular irreducibly-complex enzyme probably occurred countless times in the past, and probably was always lethal, until the environment changed, and nylon was introduced."So, the addition of a single Thymine caused a longer nucleotide chain, & new function.------------------
Occam's razor is not for shaving with.

​

[This message has been edited by mark24, 02-13-2002]

​

[This message has been edited by mark24, 02-13-2002]

quote:

---

Originally posted by KingPenguin:
by dormant i meant ignored by the mRNA.

​

---

Still not sure what you mean, how does mRNA ignore amino acids? If you explain the process a bit, I'll be able to pinpoint your exact meaning.Thanks,Mark------------------
Occam's razor is not for shaving with.

Quicksink,If you look at the bottom of a post there is a reply option. If you use this, then a poster can 1/ see who has replied to their post, & 2/ If they see your reply, can see it was in response to them, & the message no. in particular.Mark------------------
Occam's razor is not for shaving with.

Occams razor says if you have a body of evidence, then the best hypothesis is the one that explains ALL evidence, & doesn't try to explain more. eg The Biblical Flood may explain SOME features (&most of those features are debateable), if it can't explain them all, then it is a poorer model than the mainstream geological one.If you looked at an ox bow lake on a river, you would look at existing meandering bows, examine their depths etc & conclude that an ox bow lake is a "cut off" bow of a river which may/may not have dried out. To attribute more than the evidence implies means you are trying to make a point that actually has no relevance to the information you have. ie conclude that an ox bow lake is a "cut off" bow of a river which may have dried out, & that God guided the river to cut the bow off from the main river.By "Occam's razor is not for shaving", I mean be careful what you conclude from evidence.Mark------------------
Occam's razor is not for shaving with.

​

[This message has been edited by mark24, 02-15-2002]