Understanding through Discussion


Welcome! You are not logged in. [ Login ]
EvC Forum active members: 78 (8896 total)
Current session began: 
Page Loaded: 03-24-2019 11:33 AM
26 online now:
edge, PaulK, Tanypteryx (3 members, 23 visitors)
Chatting now:  Chat room empty
Newest Member: WookieeB
Post Volume:
Total: 848,618 Year: 3,655/19,786 Month: 650/1,087 Week: 19/221 Day: 19/36 Hour: 1/2


Thread  Details

Email This Thread
Newer Topic | Older Topic
  
Prev123
4
56
...
9Next
Author Topic:   Fact Theory Falacy
joz
Inactive Member


Message 47 of 136 (3842)
02-08-2002 12:23 PM
Reply to: Message 45 by TrueCreation
02-08-2002 12:20 PM


quote:
Originally posted by TrueCreation:
This seems to be a decline, which does happen, is there an example of incline?

Posted this earlier but here we go again....

From:
http://bostonreview.mit.edu/br22.1/doolittle.html

quote:
...the process of gene duplication can occur in a number of ways, and the most common mechanisms are well understood. Sexual organisms, for example, have two sets of chromosomes (one from each parent) which line up during the cell division process called meiosis. As it happens, the very long DNA threads are constantly breaking and being rejoined. The rejoining process is not 100 percent accurate, however, and often one of the chromosomes comes away with a little more of the DNA than its pairee, which will have correspondingly less. The lucky gametes that come away with the more are said to have had a "gene duplication," although the amount of DNA may amount to only a part of a gene or maybe a whole string of genes. The process can be seen in action in that there are people who have certain diseases as a result of having pieces of genes missing and other people, usually healthy, who have exactly the missing parts extra!
Thus, the result of such gene duplication is that a creature may have an old gene that encodes some protein and a new one that, under normal circumstances, has nothing much to do. Most of the time one of the duplicates will simply wither away as a result of the relentless rain of amino acid replacements that are constantly being inflicted on all proteins; natural selection cannot, after all, operate on idle proteins, but only on those that are being used. Occasionally, however, the occurrence of a new protein can be of fortuitous advantage, and it is preserved: we already have a very long list of proteins that are clearly the products of gene duplications. Indeed, one of the major goals of molecular evolutionists is to trace the family pedigree of proteins back through time in an effort to identify the small number of genes that must have been present in the earliest organisms.

Consider hemoglobin, a protein Dr. Behe has worked on professionally, and that he discusses in his book. Almost everybody knows that hemoglobin is the protein packed into red blood cells that carries oxygen around to the tissues. Behe notes that it consists of two different types of protein chain. He calls them "analogous," steadfastly refusing to call them "homologous"--a term that indicates common ancestry, and that everyone else uses. Certainly no thinking biochemist doubts that these two chains, referred to as "alpha" and "beta," are the results of a gene duplication. They are composed of 141 and 146 amino acid units, respectively, and 63 of them are exactly the same, which is to say their amino acid sequences are about 45 percent identical.

It is also well known that the foetus has a different hemoglobin in its red cells. The alpha chains are the same as the "adult" kind, but the other chain comes from another duplicated gene called "gamma." The gamma chain is also 45 percent identical with the alpha, but 70 percent identical to the beta (they share 107 amino acid units). Clearly, the gamma chain has shared ancestry more recently with the beta than it has with the alpha. It also has one very advantageous physiological property: when combined with the alpha chain it binds oxygen more tightly than does the adult hemoglobin. As a result, the foetus, which won't breathe on its own until birth, is insured of the flow of oxygen moving in its direction from the maternal circulation. As it happens, humans actually have several genes for hemoglobins, some being expressed only at embryonic stages, and one only in tissues.

We can make another family tree from hemoglobin sequences by using species comparisons instead of the duplicated genes. The tree could be based on alpha or beta hemoglobins, for example. And when we do that something interesting is observed. Because the rates of change in sequence are fairly uniform, we can gauge when the gene duplications occurred that gave rise to the alpha, beta, and gamma chains, as well as the others. It is apparent that earlier diverging animals ought not to have all the hemoglobin genes that humans have, because they diverged before particular duplications occurred. In fact, we know that jawless fish, which are the most primitive vertebrates extant, have single-chained hemoglobins in their red blood cells, because they diverged before the pivotal duplication that separated the alpha and beta chains.


IOW the original gene was duplicated then changed enough to assume a function (the duplicate had no function before as the original kept its own role), Does that qualify as new information to you?


This message is a reply to:
 Message 45 by TrueCreation, posted 02-08-2002 12:20 PM TrueCreation has not yet responded

  
TrueCreation
Inactive Member


Message 48 of 136 (3845)
02-08-2002 12:33 PM
Reply to: Message 46 by lbhandli
02-08-2002 12:22 PM


"Nylon digestion by bacteria has been observed naturally and then replicated in the lab. Of course, the words you are using are rather difficult to define. How exactly are you defining information and measuring it? What is incline and decline in a manner that is quantifiable?"
--Hm.. this is a bit tough to define, lets see what we can do. I guess it would go a little something like this:

You have:
AGTTACCCTCAAGTTC

--Mutation involves this sequence of mistranslations:
AGTTAC|CCTC|AAGTTC|

A mutation takes place and is re-arranged:
AGTTAC|GTTC|CCTCAA|

This happens ofcourse, this is another example of something that happens:

Your sequence:
GTTACTTCCCATATCCGGTGGCCAGGG

GTTACTTCCCATA|TCCGG|TGGCCAGGG|

A peice is removed and this is your product from mutation:
GTTACTTCCCATA|TGGCCAGGG|

or:

GTTACTTCCCATA|TCCGG

--This is basically what you need:

This:

AGGTCTCAACTAGTCTGGAGGCTGA

And By mutational effects get this:

|-New information-|

AGGTCTCAACT|-CTAG-|TGGA|-AGT-|TGA|-AGTAACTACCTGTG-|

--By my knowledge this seems to be what you need for new 'information' to come about.

------------------


This message is a reply to:
 Message 46 by lbhandli, posted 02-08-2002 12:22 PM lbhandli has not yet responded

Replies to this message:
 Message 49 by mark24, posted 02-08-2002 1:15 PM TrueCreation has responded

  
mark24
Member (Idle past 3274 days)
Posts: 3857
From: UK
Joined: 12-01-2001


Message 49 of 136 (3849)
02-08-2002 1:15 PM
Reply to: Message 48 by TrueCreation
02-08-2002 12:33 PM


Not sure what you're driving at TC, perhaps a definition of new information is in order?

Mark

------------------
Occam's razor is not for shaving with.

[This message has been edited by mark24, 02-08-2002]


This message is a reply to:
 Message 48 by TrueCreation, posted 02-08-2002 12:33 PM TrueCreation has responded

Replies to this message:
 Message 50 by TrueCreation, posted 02-08-2002 1:20 PM mark24 has responded

    
TrueCreation
Inactive Member


Message 50 of 136 (3850)
02-08-2002 1:20 PM
Reply to: Message 49 by mark24
02-08-2002 1:15 PM


"Not sure what you're driving at TC, perhaps a definition of new information is in order?"
--See above, I gave examples on what new information would be as a string of bases, this is what new information is to my knoweldge that 'E'volution needs.

quote:

This:

AGGTCTCAACTAGTCTGGAGGCTGA

And By mutational effects get this:

|-New information-|

AGGTCTCAACT|-CTAG-|TGGA|-AGT-|TGA|-AGTAACTACCTGTG-|


------------------


This message is a reply to:
 Message 49 by mark24, posted 02-08-2002 1:15 PM mark24 has responded

Replies to this message:
 Message 51 by joz, posted 02-08-2002 1:46 PM TrueCreation has responded
 Message 52 by mark24, posted 02-08-2002 1:51 PM TrueCreation has responded

  
joz
Inactive Member


Message 51 of 136 (3851)
02-08-2002 1:46 PM
Reply to: Message 50 by TrueCreation
02-08-2002 1:20 PM


TC you seem to have missed my earlier post so once again I refer you to post 47 at the top of this page for an example of new information....
This message is a reply to:
 Message 50 by TrueCreation, posted 02-08-2002 1:20 PM TrueCreation has responded

Replies to this message:
 Message 53 by TrueCreation, posted 02-08-2002 1:58 PM joz has not yet responded

  
mark24
Member (Idle past 3274 days)
Posts: 3857
From: UK
Joined: 12-01-2001


Message 52 of 136 (3852)
02-08-2002 1:51 PM
Reply to: Message 50 by TrueCreation
02-08-2002 1:20 PM


quote:
Originally posted by TrueCreation:
"Not sure what you're driving at TC, perhaps a definition of new information is in order?"

AGGTCTCAACTAGTCTGGAGGCTGA

And By mutational effects get this:

|-New information-|

AGGTCTCAACT|-CTAG-|TGGA|-AGT-|TGA|-AGTAACTACCTGTG-|

--See above, I gave examples on what new information would be as a string of bases, this is what new information is to my knoweldge that 'E'volution needs.


That is correct, you have nucleotide substitutions & insertions, both are known mutation types. Giving a changed, & longer sequence.

So, do we agree new information is possible as a result of mutations, then?

Mark

------------------
Occam's razor is not for shaving with.


This message is a reply to:
 Message 50 by TrueCreation, posted 02-08-2002 1:20 PM TrueCreation has responded

Replies to this message:
 Message 54 by TrueCreation, posted 02-08-2002 1:59 PM mark24 has not yet responded

    
TrueCreation
Inactive Member


Message 53 of 136 (3853)
02-08-2002 1:58 PM
Reply to: Message 51 by joz
02-08-2002 1:46 PM


I can't find where it makes relevance to something new observably coming about, could you point it out to me? It seems they are talking of how they could have come about from a previous ancestor, not giving an example of this new information coming about.

------------------


This message is a reply to:
 Message 51 by joz, posted 02-08-2002 1:46 PM joz has not yet responded

Replies to this message:
 Message 56 by mark24, posted 02-08-2002 2:46 PM TrueCreation has responded

  
TrueCreation
Inactive Member


Message 54 of 136 (3854)
02-08-2002 1:59 PM
Reply to: Message 52 by mark24
02-08-2002 1:51 PM


Is there an example?

------------------


This message is a reply to:
 Message 52 by mark24, posted 02-08-2002 1:51 PM mark24 has not yet responded

Replies to this message:
 Message 55 by joz, posted 02-08-2002 2:01 PM TrueCreation has not yet responded

  
joz
Inactive Member


Message 55 of 136 (3855)
02-08-2002 2:01 PM
Reply to: Message 54 by TrueCreation
02-08-2002 1:59 PM


Are you being deliberately obtuse TC?
This message is a reply to:
 Message 54 by TrueCreation, posted 02-08-2002 1:59 PM TrueCreation has not yet responded

Replies to this message:
 Message 58 by KingPenguin, posted 02-08-2002 3:19 PM joz has responded

  
mark24
Member (Idle past 3274 days)
Posts: 3857
From: UK
Joined: 12-01-2001


Message 56 of 136 (3856)
02-08-2002 2:46 PM
Reply to: Message 53 by TrueCreation
02-08-2002 1:58 PM


quote:
Originally posted by TrueCreation:
I can't find where it makes relevance to something new observably coming about, could you point it out to me? It seems they are talking of how they could have come about from a previous ancestor, not giving an example of this new information coming about.


You provided an example that would mean that new information had been presented.

I concur, whether it codes for anything useful is irrelevant to your example. It was a standard set by YOU, not me or Joz. The point is it COULD.

Joz has provided you with an example of entire genes being duplicated, mutating, & being useful, to his example I would add myoglobin, that stores oxygen in muscle tissue.

Is there an example of point mutations creating new functional protein?

Yes.

http://www.nmsr.org/nylon.htm

My favorite example of a mutation producing new information involves a Japanese bacterium that suffered a frame shift mutation that just happened to allow it to metabolize nylon waste. The new enzymes are very inefficient (having only 2% of the efficiency of the regular enzymes), but do afford the bacteria a whole new ecological niche. They don't work at all on the bacterium's original food - carbohydrates. And this type of mutation has even happened more than once!

Mark

------------------
Occam's razor is not for shaving with.

[This message has been edited by mark24, 02-08-2002]


This message is a reply to:
 Message 53 by TrueCreation, posted 02-08-2002 1:58 PM TrueCreation has responded

Replies to this message:
 Message 61 by TrueCreation, posted 02-09-2002 1:43 AM mark24 has responded

    
KingPenguin
Member (Idle past 5962 days)
Posts: 286
From: Freeland, Mi USA
Joined: 02-04-2002


Message 57 of 136 (3860)
02-08-2002 3:18 PM
Reply to: Message 41 by toff
02-08-2002 2:55 AM


quote:
Originally posted by toff:
That is precisely what evolution DOES explain. As so often happens, when creationists get an answer they don't like, they merely shift the goalposts.

---can we all just plz making statements like this. all it does is get us into a bickering war unstead of an actual debate/conversation.


This message is a reply to:
 Message 41 by toff, posted 02-08-2002 2:55 AM toff has not yet responded

    
KingPenguin
Member (Idle past 5962 days)
Posts: 286
From: Freeland, Mi USA
Joined: 02-04-2002


Message 58 of 136 (3861)
02-08-2002 3:19 PM
Reply to: Message 55 by joz
02-08-2002 2:01 PM


quote:
Originally posted by joz:
Are you being deliberately obtuse TC?

there we go again. wooooo sarcasm/jerkism. now im too distracted to even start reading again.

------------------
"Overspecialize and you breed in weakness" -"Major" Motoko Kusanagi


This message is a reply to:
 Message 55 by joz, posted 02-08-2002 2:01 PM joz has responded

Replies to this message:
 Message 59 by joz, posted 02-08-2002 3:31 PM KingPenguin has not yet responded

    
joz
Inactive Member


Message 59 of 136 (3862)
02-08-2002 3:31 PM
Reply to: Message 58 by KingPenguin
02-08-2002 3:19 PM


quote:
Originally posted by KingPenguin:
there we go again. wooooo sarcasm/jerkism. now im too distracted to even start reading again.

It was a serious question, despite providing exactly the sort of example TC required i was met with an answer of no it isn`t....

I was asking TC in all seriousness whether he was deliberately choosing to gainsay the very evidence he had earlier stated would be relevant....

(added by edit FYI KP I posted proof of 1+1=2 on Mooses thread of the same name last night...)

[This message has been edited by joz, 02-08-2002]


This message is a reply to:
 Message 58 by KingPenguin, posted 02-08-2002 3:19 PM KingPenguin has not yet responded

Replies to this message:
 Message 60 by TrueCreation, posted 02-09-2002 1:23 AM joz has not yet responded

  
TrueCreation
Inactive Member


Message 60 of 136 (3905)
02-09-2002 1:23 AM
Reply to: Message 59 by joz
02-08-2002 3:31 PM


"It was a serious question, despite providing exactly the sort of example TC required i was met with an answer of no it isn`t....

I was asking TC in all seriousness whether he was deliberately choosing to gainsay the very evidence he had earlier stated would be relevant....

(added by edit FYI KP I posted proof of 1+1=2 on Mooses thread of the same name last night...)"
--This wasn't what I was really doing, I was actually trying to push the converstion, I was asking you what in there talks of an observed example of new information, I find the link that mark24 gave me very interesting, I wish I was a biologist, but I'll have to look at some stuff before I am able to reply to it. But what I asked you Joz is what is the example they state? I am trying to push the conversation, not stop it with 'well that isn't what I am looking for' I won't make such an assertion definantly as of yet.

------------------


This message is a reply to:
 Message 59 by joz, posted 02-08-2002 3:31 PM joz has not yet responded

  
TrueCreation
Inactive Member


Message 61 of 136 (3906)
02-09-2002 1:43 AM
Reply to: Message 56 by mark24
02-08-2002 2:46 PM


"You provided an example that would mean that new information had been presented.

I concur, whether it codes for anything useful is irrelevant to your example. It was a standard set by YOU, not me or Joz. The point is it COULD.

Joz has provided you with an example of entire genes being duplicated, mutating, & being useful, to his example I would add myoglobin, that stores oxygen in muscle tissue."
--I am not against the biological mutation as there being possibly beneficial, I find this not as a fallacy in creationist material, but a neccessity.

"Is there an example of point mutations creating new functional protein?

Yes.

http://www.nmsr.org/nylon.htm

My favorite example of a mutation producing new information involves a Japanese bacterium that suffered a frame shift mutation that just happened to allow it to metabolize nylon waste. The new enzymes are very inefficient (having only 2% of the efficiency of the regular enzymes), but do afford the bacteria a whole new ecological niche. They don't work at all on the bacterium's original food - carbohydrates. And this type of mutation has even happened more than once!"
--I found the article very interesting, I also found this, I quote form an AiG rebutal towards an e-mail they received regarding nylon digesting bacterium:

AiG - That depends on what your definition of “information” is - http://www.answersingenesis.org/home/area/feedback/negative7-24-2000.asp

[QUOTE]
Finally, Mr Cerutti is out of date about this new nylon digesting ability allegedly from a frame shift. New evidence shows that the ability was due to plasmids

--Unfortunatelly I can't locate the reading they sighted so wouldn't be able to get more information regarding it, but I found this quote interesting.
--Also note, I am wishing I were more knowledgable in the biological field, because I am almost positive that this is going to bring in a considerably molecular biological debate, thus involving my intelligence on the subject, I'll go to the best of my ability though.

------------------

[This message has been edited by TrueCreation, 02-09-2002]


This message is a reply to:
 Message 56 by mark24, posted 02-08-2002 2:46 PM mark24 has responded

Replies to this message:
 Message 62 by mark24, posted 02-09-2002 7:33 AM TrueCreation has responded

  
Prev123
4
56
...
9Next
Newer Topic | Older Topic
Jump to:


Copyright 2001-2018 by EvC Forum, All Rights Reserved

™ Version 4.0 Beta
Innovative software from Qwixotic © 2019