MACROevolution vs MICROevolution - what is it?

The reality is that those distinct varieties and species will continue to accumulate new mutations, and that genetic diversity within those varieties and species will increase over time.

I copied this from a previous post I made in another thread, and it applies here:Let's go back to our simple gene and see how mutation, selection, and speciation work. We will start with Species OG (for original gangster).

Species OG allele A
TTTTTTTTTTTTTTTTTTTT

Speciation begins by the creation of two isolated populations of the OG population so that we have Species A and Species B

Species A allele A           Species B allele A
TTTTTTTTTTTTTTTTTTTT     TTTTTTTTTTTTTTTTTTTT

Mutation and selection occurs in each population, but since different mutations and selection pressures occur in each species they end up with different alleles:

Species A allele B            Species B allele C
TTTTTTTTTTTTTTTTATTT        TTTTTTGTTTTTTTTTTTTT

Those separate species have now diverged, all through microevolution. This same process occurs again.

Species A allele D          Species B allele E
TTCTTTTTTTTTTTTTATTT          TTTTTTGTTTTTTTGTTTTT

And it occurs again:

Species A allele F          Species B allele G
TTCTTTTTGTTTTTTTATTT           TATTTTGTTTTTTTGTTTTT

And it occurs again:

Species A allele H          Species B allele I
TTCTTATTGTTTTTTTATTT          TATTTTGTTTTCTTGTTCTT

Let's freeze time and compare these new species with the OG species

Species A allele H         Species B allele I
TTCTTATTGTTTTTTTATTT         TATTTTGTTTTCTTGTTCTT
Species OG allele A           Species OG allele A
TTTTTTTTTTTTTTTTTTTT         TTTTTTTTTTTTTTTTTTTT

That is macroevolution. We have reached the genetic divergence seen between what you would call separate kinds, and it all occurs through microevolution. Macroevolution is the accumulation of microevolutionary events, and when they occur in populations that are not interbreeding it produces divergence over time.

That is why I said that speciation begins with two isolated populations. For this example, they are beneficial mutations. It doesn't matter if they affect phenotype or not. If different mutations are accumulating in each population then speciation has occurred. If they were interbreeding then you would find the same allele in both species. There are more differences between those alleles than there is between humans and chimps, two species that creationists claim are in different kinds.

You are overlooking mutations which increase genetic diversity.

Extremely rare is often enough to keep new variations arriving on a continual basis. Mutations never stop. Selection has no purpose, as you have already been told several times now. Selection is simply what happens when you have imperfect replicators competing for limited resources. Also, all species have a spectrum of features.

Mutations keep occurring which produce new alleles for those that are fixed. Mutations are the gas stations where they keep adding new variation to the tank of evolution. Since gas is added to every tank in every generation, it never stops.

Imagine if there is a fuel station every 5 miles, and you top off the tank at every fuel station. That is how evolution works.

Please cite some references on the rarity of beneficial mutations. Otherwise, you are just making stuff up. Mutations add genetic diversity.

Prove it. I already showed that you can get a beneficial allele in the human population in less than 2 years.Let's say that there is only one possible beneficial substitution mutation in the human genome, a diploid genome that is 6 billion bases long. Since there are 3 possible substitution mutations at each position, that is 1 substitution mutation out of 18 billion possible mutations. Each human is born with about 100 substitution mutations. This means that on average you need 180 million births to get that one mutation. There are about 130 million human births per year. This means this mutation will take less than 2 years to occur.

Mutations continually add fuel.

If that were true, then every species would be homozygous for a single allele for every gene. This isn't the case.

You also have increases in genetic diversity due to mutations. There are no two salamanders that are going to be exactly alike. The genes responsible for those markers are going to have multiple alleles in the population. There are also going to be many alleles for the genes that are not responsible for those markings. Your supposed distinct populations just don't exist. That's exactly what happened in the example of the pocket mice. Selection pressures caused all of the mice to be light brown in color. After the population of all light brown mice were established a few volcano eruptions occurred which produced dark black basalt in a few areas in the desert. Mutations in those light brown mice produced black mice, and when those black mice found themselves on the black basalt rocks that trait was selected for. Now you have a mixture of black and light brown mice, an increase in genetic diversity that runs counter to everything you are claiming. That is false. What you are describing is a synonymous mutation which are thought to be largely neutral. However, changes in the protein sequence of a gene can change the phenotype, but those changes can still be neutral. There are probably mutations in some genes that affect nose length in humans, but the differences caused by those mutations are neutral with respect to fitness. We call this evolution. We are saying that species change over time due to the accumulation of mutations and selection. Then show me an organism from the species Australopithecine afarensis, or Homo erectus.

And I am saying that mutations continue to occur at every loci, and those mutations accumulate. While one loci may be under selection, other loci are not and they continue to diversify. Even the loci under selection are mutated, and new more beneficial alleles can arise from them and be selected for. It never stops. You also get new phenotypes from mutations.Edited by Taq, : No reason given.

It's a good analogy because mutations are the fuel of evolution, and that fuel is continually replenished.

That is false. Selection acts on new mutations which produce new phenotypes. That is how you get change over time. Every identifiable species, race, variety, or breed has variation where no two are identical.