Register | Sign In


Understanding through Discussion


EvC Forum active members: 64 (9163 total)
2 online now:
Newest Member: ChatGPT
Post Volume: Total: 916,419 Year: 3,676/9,624 Month: 547/974 Week: 160/276 Day: 34/23 Hour: 0/1


Thread  Details

Email This Thread
Newer Topic | Older Topic
  
Author Topic:   Problems with Mutation and the Evolution of the Sexes
lyx2no
Member (Idle past 4737 days)
Posts: 1277
From: A vast, undifferentiated plane.
Joined: 02-28-2008


Message 155 of 180 (463317)
04-15-2008 9:48 AM
Reply to: Message 154 by godservant
04-15-2008 4:05 AM


Re: A Little Help
TGTGACGTCTGACGTTGCGTAGTACGTACTGACTACGCTGAGTACGTACGTGA
TGTGACGTCTGACGTTGCGTAGTATGTACTGACTACGCTGAGTACGTACGTGA
Good morning godservant:
One of the above is a mutation of the other. Using your theory of “Mutations Only Cause a Lose of Information” can you sort out which one is the original? It should, after all, have more information.
Edited by lyx2no, : because I can.

Kindly
I've been off doing my bit to save the world, and it totally sucked.

This message is a reply to:
 Message 154 by godservant, posted 04-15-2008 4:05 AM godservant has not replied

  
Newer Topic | Older Topic
Jump to:


Copyright 2001-2023 by EvC Forum, All Rights Reserved

™ Version 4.2
Innovative software from Qwixotic © 2024