Understanding through Discussion


Welcome! You are not logged in. [ Login ]
EvC Forum active members: 85 (8951 total)
23 online now:
PaulK, Tangle, Thugpreacha (AdminPhat) (3 members, 20 visitors)
Newest Member: Mikee
Post Volume: Total: 866,946 Year: 21,982/19,786 Month: 545/1,834 Week: 45/500 Day: 3/42 Hour: 0/2


Thread  Details

Email This Thread
Newer Topic | Older Topic
  
Author Topic:   Mutations Made Easy
Quetzal
Member (Idle past 4210 days)
Posts: 3228
Joined: 01-09-2002


Message 1 of 52 (310064)
05-07-2006 6:03 PM


Background (to be deleted when PNT is acceptable): I really want to let Chiro free play in his thread Evolution Simplified, as he has a nice approach. A detailed response to NJ’s msg 46 would probably derail a very good thread. However, there are sufficient misunderstandings and other issues in that post that I feel it appropriate to address the details. I’m not entirely sure how a PNT in a case like this would work – so I’d appreciate an admin’s assistance in putting a solid PNT together. I think the issues are worth addressing. Biological Evolution would be a good place if we can get a reasonable topic established.

Quotes are from the cited message by nemesis_juggernaut.

I think any evolutionist, by necessity, eventualy will have to rest their claims on the transfer and mutation of genes. The reason why they are so adamant on this point is that the theory would collapse without it.

I’m not sure this is an accurate characterization. I fully concur that evolution would be in trouble without a demonstrable mechanism of inheritance. It would also be in trouble if there were no inheritable variations arising in a population. The good news is that we do in fact have a very good understanding of both mechanism and process. We can watch gametogenesis and meiosis in vivo under a microscope, and we have direct lab and field observations of the action of random mutation and natural selection. No inference required. “Evolutionists” don’t need to be adamant about anything – their understanding of these two elements is based on direct observation of fact; not inference.

Mathematician and molecular biologist, Harold Morowitz, calculated the odds that just one paramecium arranging DNA by chance, is: 1 in 10 to the billionth power. To help aggrandize the enormity of this improbability, 10 to the 50th power is considered, ‘absolute zero.’ When you reach absolute zero, it is so improbable that we might as well say that it is impossible. That's just to arrive at any lifeforms at all.

This is a serious mischaracterization of Morowitz’s work, and is a prime example of why people need to be careful of who, what, and from where they get their information in these discussions. Morowitz is a respected origin-of-life researcher. His dissension arises from his contention that membranes formed before other cellular components. IOW, he’s a “membrane-firster” as opposed to the “RNA Worlders” like Leslie Orgel et al. Somehow I doubt you’ve actually read Morowitz’s book, Beginnings of Cellular Life: Metabolism Recapitulates Biogenesis (Yale Uni Press, 2004), where he lays out his arguments. Bottom line: he argues that lipid bi-layer membranes represent a minimum energy state, and hence could form spontaneously providing a snug, secure environment where other chemical processes could occur and be concentrated. In other words, he completely accepts the chemical origin of life – just argues about the order of occurrence. Since I don’t have the book on hand at the moment, I can’t verify that the alleged calculations you allude to are in it, but I strongly doubt it – at least not in that form. Hopefully someone with access to a decent library can verify this. The point is kind of irrelevant anyway, so this is just a brief cautionary note about sources.

But since the First Cause can never be witnessed again, lets just speak about already extant beings for the time being. The fact is most mutations are silent. They are mostly benign deletions from copying errors in the genes. Its important to note, however, that the only reason most mutations are benign is because of specific cells that serve to repair mutations. In fact, it is their only function. Therefore, in all actuality, all mutations are truly harmful, especially if these specific cells, themselves, are the product of a mutation.

This is not entirely accurate. Most mutations (changes in the genome) are benign because they are neutral with respect to the environment. IOW, if they don’t affect the relative fitness of the organism or aren’t actually expressed, they are invisible to natural selection. “Deleterious”, “beneficial” and “neutral” are terms that describe the action of particular mutations with respect to the environment. Neutral in one environmental context may be deleterious or even beneficial in another. “Environment”, in this case, is not only the macro-scale landscape where the organism as a whole lives and interacts, but also the genetic environment inside the individual organism itself. IOW, the other genes at work affect how the mutation is treated.

Beyond that, you are gravely mistaken on both what constitutes a mutation and how the cellular machinery acts to minimize and/or repair mutation. Perhaps a brief primer is in order.

1. A mutation is simply a copying error in any DNA sequence in any cell. It can be caused by multiple factors, and there are multiple types. It is estimated that such errors occur as much as 20,000 times per day in every single cell in the human body. Unrepaired mutations in germline cells can be inherited if the mutated cell is the “lucky” one that gets fused with its counterpart during gametogenesis. Unrepaired mutations in somatic cells can cause cell death, cancer, or a few other diseases/infirmities, depending on type and severity.

2. The reason we’re still alive, in spite of all the lousy copying, is that organisms have developed exceptionally good error-correction chemistry. These error correction processes are not based on cells – most of them are enzymes such as glycosylases and DNA polymerases. We have, for instance, over 20 different genes encoding these genetic fixers, each of them capable of repairing multiple types of mutations. Even if one of the genes encoding a particular repair enzyme is itself mutated, there is sufficient redundancy to “repair the repairer” without problem – most of the time.

There would be nothing to stop these free radicals from culturing rogue, mutated cells without their assistance.

I’m sorry, but this makes absolutely no sense whatsoever. A free radical is a collection of linked atoms at least one of which contains an unpaired electron. Obviously, free radicals are highly volatile because they are able to bind with other atoms fairly easily. Sometimes this can disrupt cellular processes because radicals can chain-reaction-like create other free radicals to the point it has a more macroscale effect. There are, of course, enzymes such as superoxide dismutase and others that counteract the effects.

I think you may possibly be confusing prions with mutations. Prions are normal proteins that for some reason have changed their three-dimensional shape. They can “corrupt” other normal proteins of the same type by forcing them to configure to the prion’s new shape. It’s sort of a “chain of infection” rather than a mutation, per se. Bovine spongiform encephalitis (mad cow disease) is one example of what can happen when the system goes crazy. Proteasomes are the enzymes produced to limit or eliminate prion infection. The problem with BSE, for instance, is that its prion configuration is highly resistant to proteasome destruction. If this isn’t what you meant, I’m sorry but I have no clue what you’re talking about here. Perhaps you can clarify?

We now know that genes are composed of DNA strands, a magnificently complex molecule. DNA is an encoded message or language. The language has four letters, which form 64, three letter words. The function of the gene acts as a blueprint to tell the cell how to build a particular protein, of which I already described in a previous post how astronmically improbable it is just to arrive at one protein.

Sort of. The language analogy can be a very useful explanatory tool if it’s not taken to extremes as you do here. It’s not a language – it’s a collection of molecules that simply because of their chemical composition can’t form any other way. Because of its chemical properties, it does somewhat act like a template, and all of the various enzymes and factors in the cell are geared toward making use of it (if I can be pardoned a bit of anthropomorphic language). When we get down to the details, however, terms like “code”, “language”, “message” are highly misleading. IOW, the analogy breaks down at the chemistry level.

As far as the probability argument goes, in a trivial sense you’re correct. The odds of coming up with a specific protein on a random basis is pretty astronomical. However, given the fact that multiple protein configurations can perform the exact same function, arriving at a functional protein gets a lot easier. There’s a great deal of wiggle room for exons to encode a wide variety of amino acids that combine to perform the same function. It’s not unlimited by any stretch, but pretty wide latitude in general. This is one of the reasons that mutations are usually neutral – even if a mutation changes a gene expression a bit, it doesn’t necessarily have to be “terminal” as long as the gene still expresses amino acids that together perform the original function. In fact, it’s this ability to vary and still be functional that allows for the existence of “beneficial” mutations.

Anyway, the genes are provided with basic instructions for creating protein insulin, myoglobin, hemoglobin, etc. Though most mutations are neutral, a very large percentage is devastatingly harmful.

I won’t disagree that some mutations can be harmful. As you mention, cancer is a good example. However, I do disagree that “a very large percentage is devastatingly harmful.” You seem to be contradicting your previous statements concerning the neutrality of most mutations. Most of the time, especially in critically important sections of the genome, the genetic repair mechanisms are pretty good at fixing what’s broke. In some other areas, such as non-coding regions, mutations can actually build up without much effect. This is one of the possible explanations for the Alu repeats, for instance.

In the most rare occasions, a mutation can be beneficial. This kind of mutation is not truly advantageous, however. For instance, many evolutionists use Sickle Cell Anemia as a prime example of a good mutation.

I’m not sure I’m following you. Why would a beneficial mutation not be advantageous? As to your second point, I don’t think you’ll find too many people saying that sickle cell anemia is a “good” mutation, at least not taken out of its environmental context (remember, environment includes the other genes). Even then, most of us would (I think) characterize sca as deleterious – but less so than malaria infection. It is certainly very deleterious in its own right outside of malaria-endemic areas. Here’s the rub: sca is fatal if homozygous. In Central Africa, life expectancy of a child homozygous for sca is five years (from Sergeant GR 2005, Mortality from sickle cell disease in Africa, BMJ 330:432-433). It’s obviously very different in the West, where supportive measures can be implemented. Malaria also has a high mortality rate if untreated in endemic areas. It is responsible for at least 10% of infant mortality, and as much as 25% of mortality in children 1-4 (see Hempel J 1999, Malaria in Tropical Africa - Estimated Incidence and Mortality), throughout Central Africa. Sickle cell is not an example of a “beneficial” mutation. It’s used as an example of how a deleterious trait can be maintained as a polymorphism in a population over time. Kids with sickle cell disease die. Kids with malaria are likely to die. Kids that are heterozygous for the sickle cell trait may not be healthy, but given the relative protection gained against malaria, they usually live long enough to reproduce – and pass on their crap-shoot genetic legacy.

What they fail to realize is, the more individuals that procreate, the greater and more frequent the disease will be, and the less the immunity will be. The ‘immunity’ will literally be bred out of existance.

As I just explained above, the trait is maintained in the population. The disease itself is a byproduct of this polymorphism. You are confusing genetic disease with parasitical/bacterial/viral disease, I think. You can’t change the level of immunity conferred by the trait unless somehow the parasite (in this case) evolves to “get around” the sickle cell structure. One possible reason why this hasn’t occurred is that there are more than sufficient victims without the trait that it hasn’t been a significant selection pressure on the parasite.

Aside from this, its as if no one has taken into consideration how terrible this disease really is? So, you don’t have Malaria, but now you have Sickle Cell Anemia?

That’s just the point: heterozygotes with the trait don’t develop the disease. They’re a bit anemic, but not fatally so. The folks (primarily kids) who develop full-blown sca die without extensive support. Period.

So, that's how I disagree that mutation could be the propulsion of macroevolution. In other words, it effects reproduction because the more people breed, the more this disease will effect us by removing the immunity. Therefore, I don't agree that SCA, or any other mutation, could be advantageous.... (I'll be cautious here): There are no truly advantageous mutations that I know of and I've heard lots of testimonies on it.

Unfortunately, this conclusion doesn’t follow from the argument very well. The example you cited, sickle cell anemia, doesn’t cause changes in immunity to malaria. Possession of the trait in a heterozygous condition does. Since it’s a genetic trait, rather than an immune response, Malaria falciparum parasites haven’t evolved to get around it. Indeed, malaria can live quite comfortably in a heterozygote’s bloodstream and be transferred via its normal vector. The carrier simply doesn’t develop a full-blown malaria infection.

Discussion of advantageous mutations will have to wait a bit. However, as you said “that you’ve heard of” may be an indicator that you haven’t been following the literature very closely.


Replies to this message:
 Message 3 by kalimero, posted 05-08-2006 8:12 AM Quetzal has responded
 Message 8 by Hyroglyphx, posted 05-08-2006 3:14 PM Quetzal has responded

  
AdminNosy
Administrator
Posts: 4754
From: Vancouver, BC, Canada
Joined: 11-11-2003


Message 2 of 52 (310108)
05-07-2006 8:28 PM


Thread moved here from the Proposed New Topics forum.

  
kalimero
Member (Idle past 783 days)
Posts: 251
From: Israel
Joined: 04-08-2006


Message 3 of 52 (310226)
05-08-2006 8:12 AM
Reply to: Message 1 by Quetzal
05-07-2006 6:03 PM


“Deleterious”, “beneficial” and “neutral” are terms that describe the action of particular mutations with respect to the environment.

{bold mine}

I think you mean "detrimental", because "Deleterious" means something else in genetics - the loss of one or more nucleotides, completely, from the genome.

BTW - SCA/SCT is a point mutation.


This message is a reply to:
 Message 1 by Quetzal, posted 05-07-2006 6:03 PM Quetzal has responded

Replies to this message:
 Message 4 by Modulous, posted 05-08-2006 8:39 AM kalimero has responded
 Message 5 by Quetzal, posted 05-08-2006 9:04 AM kalimero has not yet responded

  
Modulous
Member (Idle past 442 days)
Posts: 7789
From: Manchester, UK
Joined: 05-01-2005


Message 4 of 52 (310235)
05-08-2006 8:39 AM
Reply to: Message 3 by kalimero
05-08-2006 8:12 AM


Are you sure you aren't confusing deleterious with deletion?

This message has been edited by Modulous, Mon, 08-May-2006 01:51 PM


This message is a reply to:
 Message 3 by kalimero, posted 05-08-2006 8:12 AM kalimero has responded

Replies to this message:
 Message 6 by Quetzal, posted 05-08-2006 9:24 AM Modulous has not yet responded
 Message 7 by kalimero, posted 05-08-2006 1:39 PM Modulous has not yet responded

  
Quetzal
Member (Idle past 4210 days)
Posts: 3228
Joined: 01-09-2002


Message 5 of 52 (310242)
05-08-2006 9:04 AM
Reply to: Message 3 by kalimero
05-08-2006 8:12 AM


I think you mean "detrimental", because "Deleterious" means something else in genetics - the loss of one or more nucleotides, completely, from the genome.

Hi K,

Thanks for your feedback. However, I’m afraid you’re mistaken. “Deleterious” is the correct term. A deletion, as you mention, is a type of mutation. “Detrimental” can be used as a description of the result of the mutation, but is not the accepted terminology for what I was describing. Here are a couple of articles which you might find of interest:

Barash D, 2003, “Deleterious mutation prediction in the secondary structure of RNAs”, Nucleic Acids Research 31:6578-6584

Eyre-Walker A and Keightly PD, 1999, “High genomic deleterious mutation rates in hominids.”, Nature 397:344-347

Palmer ME, and Lipsitch M, 2006, The Influence of Hitch-Hiking and Deleterious Mutation upon Asexual Mutation Rates, Genetics (article published ahead of print)

BTW - SCA/SCT is a point mutation.

Right, it a single-substitution mutation where valine replaces glutamic acid. The sequence goes something like this:

HbA (normal): CTGACTCCTGAGGAGAAGTCT
HbS (sickle): CTGACTCCTGTGGAGAAGTCT

Hopefully, if NJ decides to participate in this thread, we can get into more detail on types and causes of mutations. I'll very much appreciate your help on that when (and if) NJ decides to join us.


This message is a reply to:
 Message 3 by kalimero, posted 05-08-2006 8:12 AM kalimero has not yet responded

  
Quetzal
Member (Idle past 4210 days)
Posts: 3228
Joined: 01-09-2002


Message 6 of 52 (310251)
05-08-2006 9:24 AM
Reply to: Message 4 by Modulous
05-08-2006 8:39 AM


Damn, beat me to it. And much more succinct to boot... :D

This message is a reply to:
 Message 4 by Modulous, posted 05-08-2006 8:39 AM Modulous has not yet responded

  
kalimero
Member (Idle past 783 days)
Posts: 251
From: Israel
Joined: 04-08-2006


Message 7 of 52 (310312)
05-08-2006 1:39 PM
Reply to: Message 4 by Modulous
05-08-2006 8:39 AM


Are you sure you aren't confusing deleterious with deletion?

I guess I am.

Thanks for your feedback. However, I’m afraid you’re mistaken. “Deleterious” is the correct term. A deletion, as you mention, is a type of mutation. “Detrimental” can be used as a description of the result of the mutation, but is not the accepted terminology for what I was describing.

Oh, OK. I didnt know that thanx :) .

BTW - I go to Ben-Gurion Univ.


This message is a reply to:
 Message 4 by Modulous, posted 05-08-2006 8:39 AM Modulous has not yet responded

Replies to this message:
 Message 29 by Brad McFall, posted 05-09-2006 4:14 PM kalimero has not yet responded
 Message 30 by Brad McFall, posted 05-09-2006 4:15 PM kalimero has not yet responded

  
Hyroglyphx
Member
Posts: 5874
From: Austin, TX
Joined: 05-03-2006
Member Rating: 2.4


Message 8 of 52 (310343)
05-08-2006 3:14 PM
Reply to: Message 1 by Quetzal
05-07-2006 6:03 PM


Gene transfer
quote:
We can watch gametogenesis and meiosis in vivo under a microscope, and we have direct lab and field observations of the action of random mutation and natural selection. No inference required. “Evolutionists” don’t need to be adamant about anything – their understanding of these two elements is based on direct observation of fact; not inference.

No one is contesting that mutations occur, especially during meiosis and mitosis. I'm not following how this presents a strong argument on your side in how it propagates a macroevolutionary progress.

quote:
Morowitz is a respected origin-of-life researcher.

I wasn't making inferring that Morowitz and I share commonality. He isn't a creationist. But I see him as somebody that simply reports the facts without an agenda -something quite rare in the scientific community, IMO. I know who he is and what he does. One of his peeves is for people to assert that life originated at random. For starters, my reason for mentioning him has to do with two premises.
1. Impossibility of abiogenesis (which he dispells)
2. Thermodynamics in living systems (which he agrees with)

I was flamed for mentioning abiogenesis as being OT. And I was flamed for asserting that thermodynamic principles don't only apply to closed systems.

The author of several books, Morowitz has written extensively on the thermodynamics of living systems, as well as on popular science topics. In his current research, he is investigating the interface of biology and information sciences and continues the exploration of the origins of life.

Since neither of these two things are relevant to our current topic, I'll let this one alone.

quote:
you are gravely mistaken on both what constitutes a mutation and how the cellular machinery acts to minimize and/or repair mutation. Perhaps a brief primer is in order.

All that I mentioned was that most mutations are benign (which they are), or that they cause serious adverse effects (which they do). But the clincher is, a beneficial mutation is so rare, and so sparingly understood, that the liklihood of it propagating a mcaroevolutionary method is extremely unlikely even in one population, let alone, all of them. I then went on to say that all mutations are deemed 'harmful' to the body and that the body treats all mutations as detrimental. DNA repair exists for a reason. I'm not sure what you are even arguing against.

quote:
Obviously, free radicals are highly volatile because they are able to bind with other atoms fairly easily.

What don't you understand about my reasoning for mentioning it? There are several methods the body uses to repair damaged cells, and free radicals disrupt normal, healthy cellular activity. We have nucleotid repair, base pair repair, mismatched repair, all of which excises mutated gametes.

quote:
I think you may possibly be confusing prions with mutations.

No, I'm not talking about prions, because prions come from the outside in, instead of the inner-components of the cell mutating. Prions deal with how diseases from an outside source effect the body, like Mad Cow disease. I'm talking about free radicals and how the body combats it.

quote:
The language analogy can be a very useful explanatory tool

I never meant for it to be more than an analogy.

quote:
given the fact that multiple protein configurations can perform the exact same function, arriving at a functional protein gets a lot easier.

Assuming that a series of recombinations and deletions within the genome or even its base pairs could increase in complexity, is like saying if we copied the first page of the Dictionary, we'd somehow arrive at a complete Dictionary and in sequential order. Life doesn't organize itself in this way.

quote:
I do disagree that “a very large percentage is devastatingly harmful.” You seem to be contradicting your previous statements concerning the neutrality of most mutations.

Most mutations are silent. A large percentage of the total sum is detrimental. There is no contradiction. And we shouldn't forget that the only reason some mutations aren't harmful is because the of cell repair.

quote:
I’m not sure I’m following you. Why would a beneficial mutation not be advantageous?

http://www.cs.unc.edu/~plaisted/ce/problem2.html

quote:
As I just explained above, the trait is maintained in the population. The disease itself is a byproduct of this polymorphism. You are confusing genetic disease with parasitical/bacterial/viral disease, I think.

That's interesting because I thought that's what you were doing when you introduced prions into the equation, instead of taking what I said about Free Radicals for face value.

quote:
The example you cited, sickle cell anemia, doesn’t cause changes in immunity to malaria. Possession of the trait in a heterozygous condition does.

If two people with the Sickle Cell gene procreate, then the progeny will be affected by the full blown disease. Therefore, the immunity will be bred out of existence when more, and more people populate. Where's the ambiguity in that?


This message is a reply to:
 Message 1 by Quetzal, posted 05-07-2006 6:03 PM Quetzal has responded

Replies to this message:
 Message 9 by crashfrog, posted 05-08-2006 3:33 PM Hyroglyphx has not yet responded
 Message 10 by PaulK, posted 05-08-2006 3:35 PM Hyroglyphx has not yet responded
 Message 11 by lfen, posted 05-08-2006 3:42 PM Hyroglyphx has not yet responded
 Message 12 by Chiroptera, posted 05-08-2006 3:48 PM Hyroglyphx has not yet responded
 Message 13 by Quetzal, posted 05-08-2006 5:26 PM Hyroglyphx has responded

  
crashfrog
Inactive Member


Message 9 of 52 (310349)
05-08-2006 3:33 PM
Reply to: Message 8 by Hyroglyphx
05-08-2006 3:14 PM


Re: Gene transfer
If two people with the Sickle Cell gene procreate, then the progeny will be affected by the full blown disease.

They don't teach genetics in high school anymore?

If two heterozygotes for SCA mate, only (on average) one out of every 4 of their offspring will be homozygous SCA. Two out of four will be heterozygotes like their parents, and one out of four won't have any copies of the gene at all.


This message is a reply to:
 Message 8 by Hyroglyphx, posted 05-08-2006 3:14 PM Hyroglyphx has not yet responded

  
PaulK
Member
Posts: 15632
Joined: 01-10-2003
Member Rating: 2.8


Message 10 of 52 (310350)
05-08-2006 3:35 PM
Reply to: Message 8 by Hyroglyphx
05-08-2006 3:14 PM


Re: Gene transfer
quote:

If two people with the Sickle Cell gene procreate, then the progeny will be affected by the full blown disease. Therefore, the immunity will be bred out of existence when more, and more people populate. Where's the ambiguity in that?

No ambiguity but a big error. Basic genetics - and I mean that it would be nothing new to Mendel - says that if two heterozygous individuals breed, statistically, half of their offspring will also be heterozygous. Only 1/4 of their offspring would have the full-blown condition (the other 1/4 would be "normal" - no sickle-cell at all).

And you will have to explain why
this
article shows that a beneficial mutation would not be beneficial. It looks like a confused mess to me.
n

This message has been edited by PaulK, 05-08-2006 03:52 PM


This message is a reply to:
 Message 8 by Hyroglyphx, posted 05-08-2006 3:14 PM Hyroglyphx has not yet responded

  
lfen
Member (Idle past 3016 days)
Posts: 2189
From: Oregon
Joined: 06-24-2004


Message 11 of 52 (310352)
05-08-2006 3:42 PM
Reply to: Message 8 by Hyroglyphx
05-08-2006 3:14 PM


Re: Gene transfer
If two people with the Sickle Cell gene procreate, then the progeny will be affected by the full blown disease. Therefore, the immunity will be bred out of existence when more, and more people populate. Where's the ambiguity in that?

NJ,

It's fundamental mistakes like this that is making it almost impossible for you to understand genetics and to understand the theory of evolution (not neccesarily accept it but to understand it) you need to take some time to learn basic genetics.

If two people each of whom only has one chromosome with the sickle cell gene mate the odds are 1 in 4 (there may be somethings that modify those odds, I will confess my genetic knowledge is growing dated) that a child will get both genes and thus develope sickle cell anemia. The odds are again 1 in 4 that the child won't get copies of the sickle cell gene at all and so can't pass them along, and 50/50 that it will carry one gene.

I don't enjoy the math part but you can't just skip over it with "extremely unlikelys". How likely is it to win the Powerball lottery? How many people have won the lottery?

But the clincher is, a beneficial mutation is so rare, and so sparingly understood, that the liklihood of it propagating a mcaroevolutionary method is extremely unlikely even in one population, let alone, all of them. I then went on to say that all mutations are deemed 'harmful' to the body and that the body treats all mutations as detrimental. DNA repair exists for a reason. I'm not sure what you are even arguing against.

In terms of genetics the genes we are concerned about are the egg and sperm cells. Mutations elsewhere are not going to be transmitted to offspring.

It is beginning to sound to me like you are trying to argue away evolution without first understanding basic genetics and all I see you doing is creating a mixed up muddle. I don't mean this as an unfriendly criticism but as serious advice: learn about genetics and how it works and how it's studied.

lfen


This message is a reply to:
 Message 8 by Hyroglyphx, posted 05-08-2006 3:14 PM Hyroglyphx has not yet responded

  
Chiroptera
Member
Posts: 6833
From: Oklahoma
Joined: 09-28-2003
Member Rating: 7.0


Message 12 of 52 (310353)
05-08-2006 3:48 PM
Reply to: Message 8 by Hyroglyphx
05-08-2006 3:14 PM


Re: Gene transfer
Hi, nemesis.

quote:
But the clincher is, a beneficial mutation is so rare, and so sparingly understood, that the liklihood of it propagating a mcaroevolutionary method is extremely unlikely even in one population, let alone, all of them.

Is this another theoretical argument that ends up getting trumped by the huge amount of real life evidence that shows that life has evolved over three and a half billion years?

--

By the way, I did write a response in our continuing dialogue in the Evolution Simplified thread. No problems if need time to compose your response (I'm patient) -- I just want to make sure you didn't miss it among all the other posts.


"Religion is the best business to be in. It's the only one where the customers blame themselves for product failure."
-- Ellis Weiner (quoted on the NAiG message board)

This message is a reply to:
 Message 8 by Hyroglyphx, posted 05-08-2006 3:14 PM Hyroglyphx has not yet responded

  
Quetzal
Member (Idle past 4210 days)
Posts: 3228
Joined: 01-09-2002


Message 13 of 52 (310367)
05-08-2006 5:26 PM
Reply to: Message 8 by Hyroglyphx
05-08-2006 3:14 PM


Re: Gene transfer
No one is contesting that mutations occur, especially during meiosis and mitosis. I'm not following how this presents a strong argument on your side in how it propagates a macroevolutionary progress.

It wasn't intended to provide a strong argument. That part of my response was directed at your statement:

quote:
I think any evolutionist, by necessity, eventualy will have to rest their claims on the transfer and mutation of genes. The reason why they are so adamant on this point is that the theory would collapse without it.
I agreed with this, and then went on to point out that since we've got the evidence for both inheritable variation and a mechanism for producing it, evolution isn't in much trouble. Good thing, eh?

wasn't making inferring that Morowitz and I share commonality. He isn't a creationist. But I see him as somebody that simply reports the facts without an agenda -something quite rare in the scientific community, IMO. I know who he is and what he does. One of his peeves is for people to assert that life originated at random. For starters, my reason for mentioning him has to do with two premises.

Good thing you weren't trying to compare the two of you. However, let me refresh your memory of what you stated:

quote:
Mathematician and molecular biologist, Harold Morowitz, calculated the odds that just one paramecium arranging DNA by chance, is: 1 in 10 to the billionth power. To help aggrandize the enormity of this improbability, 10 to the 50th power is considered, ‘absolute zero.’ When you reach absolute zero, it is so improbable that we might as well say that it is impossible. That's just to arrive at any lifeforms at all.
I responded by expressing doubt Morowitz would have said this. As indeed he didn't. YOU were attempting to draw a completely unwarranted parallel between an unreferenced calculation attributed to him and your own conclusion (bolded portion). I just wanted to make sure you (and potential readers) were aware that the bolded section is NOT one of Morowitz's conclusions.

For starters, my reason for mentioning him has to do with two premises.
1. Impossibility of abiogenesis (which he dispells)
2. Thermodynamics in living systems (which he agrees with)

Unfortunately for your argument on Chiro's thread, both of these two points completely refute your arguments using them on that thread. You were arguing (if I remember correctly) that the 2dLOT made evolution impossible. Morowitz's arguments on thermodynamics actually present the equations showing how cellular precursors can actually spontaneously appear (the Gibbs free energy state of a lipid bi-layer I mentioned).

Enough, I agree, on origin of life. I was only discussing your misuse of Morowitz's work. Hope its clearer now.

All that I mentioned was that most mutations are benign (which they are), or that they cause serious adverse effects (which they do). But the clincher is, a beneficial mutation is so rare, and so sparingly understood, that the liklihood of it propagating a mcaroevolutionary method is extremely unlikely even in one population, let alone, all of them.

Since I've never been able to figure out how to post equations to this board, I'll have to simplify things by stating that the probability p of fixation of a beneficial allele is approx. twice that of the selective advantage, or p=2s. This is a derivative of the Hardy-Weinberg and Fisher equations. There's a lot of literature on the subject, however. For a more detailed discussion (including the relevant equations), see for example de Oliveira VM and Campos PRA 2006, Dynamics of fixation of advantageous mutations or see Otto SP, and Whitlock MC, 1997, The Probability of Fixation in Populations of Changing Size Genetics 146:723-733. For a full, detailed treatment, see Futuyma D 1998, Evolutionary Biology, Sinauer Ass. page 376.

I then went on to say that all mutations are deemed 'harmful' to the body and that the body treats all mutations as detrimental. DNA repair exists for a reason. I'm not sure what you are even arguing against.

Heh. I wasn't even arguing. I was pointing out/correcting your complete misunderstanding of genetics evidenced in this statement:

quote:
The fact is most mutations are silent. They are mostly benign deletions from copying errors in the genes (FALSE: There are multiple types of mutation, from frame shift to substitution). Its important to note, however, that the only reason most mutations are benign is because of specific cells that serve to repair mutations.(FALSE: Enzymes are the repair mechanisms. They are found within the cell. They are not cells.) In fact, it is their only function.

The "false" statements are what I addressed with my "mini primer". Do you understand the 2 points I raised? If not, I'll be happy to explain them further.

What don't you understand about my reasoning for mentioning it? There are several methods the body uses to repair damaged cells, and free radicals disrupt normal, healthy cellular activity. We have nucleotid repair, base pair repair, mismatched repair, all of which excises mutated gametes.

Maybe it was this bit:

quote:
Therefore, in all actuality, all mutations are truly harmful, especially if these specific cells, themselves, are the product of a mutation. There would be nothing to stop these free radicals from culturing rogue, mutated cells without their assistance.
In the first place, "free radicals" aren't mutations. In the second, they don't culture rogue cells. They are clusters of atoms with at least one spare electron. They can bind to other atoms. They may be a cause of mutation occasionally (google on "reactive oxygen species", for instance). I brought up my lack of understanding of your point because nothing you wrote in the quoted section made any sense. This is also why I thought you might have been talking about prions - in a sense they are able to "culture rogue" proteins (not cells). Pardon my confusion, but you really need to be careful how you use terminology in these kinds of discussions. It can get very confusing otherwise.

Assuming that a series of recombinations and deletions within the genome or even its base pairs could increase in complexity, is like saying if we copied the first page of the Dictionary, we'd somehow arrive at a complete Dictionary and in sequential order. Life doesn't organize itself in this way.

Erm, no. My point was that there are several possible combinations of amino acids that can produce the same functional protein. There are also multiple combinations of nucleotides that can produce the same amino acid. One of the reasons that mutation is most often neutral. "No harm, no foul" mutations, basically. Has nothing at all to do with complexity or dictionaries.

Most mutations are silent. A large percentage of the total sum is detrimental. There is no contradiction. And we shouldn't forget that the only reason some mutations aren't harmful is because the of cell repair.

You're again contradicting yourself in the same way. Either mutations are mostly neutral, or they're mostly detrimental. You can't have two majorities. And, once again, cell repair is only one of the reasons most mutations are neutral with regard to fitness.

http://www.cs.unc.edu/~plaisted/ce/problem2.html

This is a response to my question? For future reference, I never debate websites. Bare links do not an argument make. In this instance, I'll give you a quick comment:

Plaisted is wrong. His spurious equations and hypothetical population show absolutely nothing. He neglects the action of purifying selection on mutation, neglects the fact not all of his "mutant" offspring will reproduce thus reducing the population's overall mutational load, and he fails to take into consideration gene flow from other populations. In other words, he plays mathematical games to buffalo the incredulous. Sort of like his partner in crime Dembski.

If two people with the Sickle Cell gene procreate, then the progeny will be affected by the full blown disease. Therefore, the immunity will be bred out of existence when more, and more people populate. Where's the ambiguity in that?

A lot of other people have already picked up on this. Saves me from trying to draw a Venn diagram on a message board. Any part of their responses you didn't understand?


This message is a reply to:
 Message 8 by Hyroglyphx, posted 05-08-2006 3:14 PM Hyroglyphx has responded

Replies to this message:
 Message 15 by Wounded King, posted 05-09-2006 5:58 AM Quetzal has responded
 Message 16 by Hyroglyphx, posted 05-09-2006 9:02 AM Quetzal has responded
 Message 32 by scoff, posted 05-10-2006 7:09 PM Quetzal has responded

  
Quetzal
Member (Idle past 4210 days)
Posts: 3228
Joined: 01-09-2002


Message 14 of 52 (310394)
05-08-2006 6:58 PM


To lfen, Crash and PaulK
Exactly right - all of ya's. What's interesting about the heterozygous cross in this case is that both the two homozygous offpsring - or 50% of the F1 generation - are likely to die before they can reproduce. 25% from SCA, 25% from malaria. Lovely choices, no?

  
Wounded King
Member (Idle past 2433 days)
Posts: 4149
From: Edinburgh, Scotland
Joined: 04-09-2003


Message 15 of 52 (310449)
05-09-2006 5:58 AM
Reply to: Message 13 by Quetzal
05-08-2006 5:26 PM


Re: Gene transfer
Saves me from trying to draw a Venn diagram on a message board.

Wouldn't a punnett square be more suitable?

TTFN,

WK


This message is a reply to:
 Message 13 by Quetzal, posted 05-08-2006 5:26 PM Quetzal has responded

Replies to this message:
 Message 17 by Quetzal, posted 05-09-2006 9:07 AM Wounded King has not yet responded

  
Newer Topic | Older Topic
Jump to:


Copyright 2001-2018 by EvC Forum, All Rights Reserved

™ Version 4.0 Beta
Innovative software from Qwixotic © 2019