What about those jumping genes?

For the third time.Transposons are 45% of the human genome.An intron can be a transposon. "Intron" just means "intervening sequence".But you are mixing up "tsetse fly genetic material" and "transposon" again.A piece of the tsetse fly genome is DIFFERENT from a transposon.The fact that humans and flies share a transposon is not surprising.As I pointed out earlier, both could have gotten the transposon from a common parasite.

HM. You realize, don't you, that the human genome is 3.2 billion bp? And that there are approximately 30,000 genes, each with an average length of 1000bp?That means 1.35 billion bp are transposons and/or introns.I can't tell you the origin of each of these transposons. There are over 14 families of transposons in the human genome.There are over a million SINEs alone (Short Interspersed Nuclear Elements aka a type of transposon).The mariner element that we have been talking about has been researched extensively, however.Here's one cite:Tiggers and Other DNA Fossils in the Human Genome, Proceedings of the National Academy of the Sciences, vol 93, p. 1443-1448, 1996If you're interested, take a look.And take a look at this:Element.........Human...Fly.....Worm....ArabidopisLINE/SINE.......33.4%...0.7%....0.4%....0.5%
LTR.................8.1%.....1.5%....0.0%.....4.8%
DNA................2.8%.....0.7%....5.3%.....5.1%
All TEs.............44.4%...3.1%....6.5%.....10.5%http://nitro.biosci.arizona.edu/.../lecture26/lecture26.htmlYou think tsetse flies bit that Arabidopsis plant?Edited by molbiogirl, : No reason given.

Just a moment...How did those tsetse flies manage to bite sea anemones?

The fullest account available that I can find seems to be the from a report to the Novel Foods and Processes Advisory Committee.This report doesn't really give any more detail of the methodology than New Scientist did. It sounds like they just used publicly available sequences from Genbank and I can only find 3 such sequences linked to the mariner transposon. Of these one 'Glossina palpalis Tsetse.fly.3 mariner transposase gene, partial cds', which I already mentioned, pulls out human mariner sequences with high levels of similarity.However if you take that similar human sequence and BLAST it you will not get the Tsetse sequence coming out as the highest non-human hit. There are several primate sequences before it, as well as sheep and cow sequences. It seems much more likely that the Tsetse fly has at some point acquired the transposon, through whatever vector, from the primate lineage than the other way round. I'd agree with molbiogirl that it seems much more plausible for some infective vector such as a virus or intracellular parasite to act as the carrier of the transposon than for their to be any incorporation of naked DNA in either direction directly between human and fly.The report makes the rather vague statement... Which unfortunately is so vague it doesn't allow us to discriminate between the two scenarios to work out what the authors thought occurred.I would be quite happy to agree there is some evidence for a transfer of genetic material between the human primate lineage and the Tsetse fly but I strongly contest that there is any evidence that such a transfer would involve the incorporation of naked DNA directly from one to the other over its having been transmitted by some sort of infective vector. Molbiogirl's alternative hypothesis that the common sequence is the result of transmission from some common infective vector in both cases seems equally viable.TTFN,WK

WK wrote: You and molbiogirl make strong arguments about the "chemicality" of genes, if I may be so crude. TEs have to take chemical steps 1 thru 5 to get anywhere, as mbg asserts. In your cited reference, Glossina palpalis Tsetse.fly.3 mariner transposase gene, partial cds, this sequence of the "tsetse-fly 3 mariner transposon" is reported :

quote:

---

GAACGAGAATCAAAAAAATCGCCGTTTTGAAGTATCGTCCTCTCTCCTTTTGCGCAACAACGAC
GATCCATTTCTTAACCGGATTGTGACATGCGATGAAAAGTGGATTCTTTACGACAATCGGCGGC
GGTCGGCACAGTGGTTAGACGCTGATGAAGCTCCACAACACTTCCCCAAGCCCAAACTCCACCA
AAAGAAGATCATGGTGACTGTTTGGTGGTCAGCAGTAGGTTTGATACACCACAGCTTCCTGAAT
CCGGGCGAAACCATTACAGCCGAGAAGTATTGTCAACAAATCGACGAGATGCACCAGAGGCTTC
AACAAAAACAGCCGGCATTGGTCAACAGAAAAGGCCCAATTCTCCTACATGATAACGCACGACC
ACACGTTTCAATGATCACGCGACAAAAGCTGTATGAGTTGGGTTATGAAACTCTCGATCACCCA
CCA

---

What we have here is a digital encryption of said same transposon. It is the "digitality" of genes that fascinates me and ignites my imagination about how they can morph and leap around amongst populations as "pure information" (Dawkins). Because of this kind of "infostructure," if you will, I want to see genetic careers in transposition as engaging more than mere chemical reactions, which are only perfunctory. (Ringo will snort about this, I know.)What I see is a gambetto of macromolecular codes that have extraordinary talents for structural creativity and mobility. Biological evolution is entirely dependent upon these digital codes for encrypting and communicating structural information by way of the nucleotides in those macromolecules. Nowehere else in nature do such things happen. Rocks are not so well informed. It's all about the code; there's nothing very special about the digital nucleotides A,C,T, and G or the atoms they comprise.Genes jump because they are pure information”"lighter than molecular air"”not because DNA molecules have strong legs and sticky feet.”HM

This just strikes me as arrant nonsense. It sounds like the informational equivalent of all the spurious appeals to quantum physics made by the purveyors of woo to support any ludicrous claim they fancy.Do you have any conceivable method by which such information could be transmitted between organisms independent of their molecular medium?TTFN,WK

molbiogirrl writes: mbg, are you saying this helps your argument? Seems to me, then, that 45% of the human genome is in a state of transposition. What you are saying, in effect, is that the human genome is a pluarity of jumping genes. Would it make any difference to the human genome if those jumping genes were to migrate somewhere else?”HM

WK asks: Yes, here's a method: When one human organism orders a gene over the Internet he/she may specify to another human organism that specifc gene in digital code, such as:

quote:

---

GAACGAGAATCAAAAAAATCGCCGTTTTGAAGTATCGTCCTCTCTCCTTTTGCGCAACAACGAC
GATCCATTTCTTAACCGGATTGTGACATGCGATGAAAAGTGGATTCTTTACGACAATCGGCGGC
GGTCGGCACAGTGGTTAGACGCTGATGAAGCTCCACAACACTTCCCCAAGCCCAAACTCCACCA
AAAGAAGATCATGGTGACTGTTTGGTGGTCAGCAGTAGGTTTGATACACCACAGCTTCCTGAAT
CCGGGCGAAACCATTACAGCCGAGAAGTATTGTCAACAAATCGACGAGATGCACCAGAGGCTTC
AACAAAAACAGCCGGCATTGGTCAACAGAAAAGGCCCAATTCTCCTACATGATAACGCACGACC
ACACGTTTCAATGATCACGCGACAAAAGCTGTATGAGTTGGGTTATGAAACTCTCGATCACCCA
CCA

---

No molecular medium is required (other than human brains and computers, I suppose) to communicate this genetic information...ah, but "spurious appeals to quantum physics made by the purveyors of woo to support any ludicrous claim they fancy" notwithstanding.Love that woo!”HM

So that would be a no.If you think that is what a jumping gene is then once again you have shown that rather than biology you prefer the science of making rubbish up and glib nonsense.TTFN,WK

WK wrote: But would agree that the "digitality" of genes is the essential feature affording them their ability to jump? Quartz-cyrstal information doesn't jump from rock to rock, you know. But prfotein-structure information can jump from male to female, from population to population, and from species to species.I'm trying to look at this from some kind of a bigger persspective. And, yes, the woo factor is a hazard to this endeavor. I'm just as woo-phobic as you. Isn't there a middle ground? Couldn't it be a digital middle gound?”HM

No. "A state of transposition" means "in the act of transposing". As I pointed out upthread, the vast majority of the transpositional elements are inactive.In fact, they are rendered inactive by the host genome. It's a sort of "genomic viral firewall" that host genomes have developed over the years to protect their information. Otherwise, TEs would be monkeying around with the code all the time. Remember? The vast majority of transposons in vertebrates DO NOT MOVE. Well, you're right about DNA not jumping. It absolutely doesn't.Transposons do, however. They jump "due to sticky feet". Their sticky ends, actually, after transposase cuts them.I'm going to repeat this one more time, s-l-o-w-l-y, so you understand.The. Vast. Majority. Of. Transposons. In. The. Human. Genome. Are. Not. Autonomous. Nope.DNA does what DNA does because of its chemical structure. Proteins do what proteins do because of their chemical structures.Information is not some ethereal presence that motivates genes. You're being awfully footloose and fancy free with your definitions."Communication" in a biological organism, whether that communication is a protein transcribed from the genetic code or the signalling cascade induced by insulin, is entirely molecular. Period. Full stop.If I were to use your "definition" of communication, I could say:Craig Venter's genomic information is [insert Craig's recently published genome].I've just "received" Craig's genetic information.Therefore, I'm pregnant.Edited by molbiogirl, : awkward grammar

molbiogirl writes: You are correct; my mistake. Love that cyber-world metaphor! Yes, I must agree. Transposons are not DNA? What are they then? Oh, thanks. I think I got it. Well, that depends. Did you keep your virtual knees togother?”HM

molbiogirl, I'm still waiting for you to explain how DNA does not jump but transposons do. You are saying here that transposons are not DNA. I am asking: Then what are they?Yes, there is a "chronic misunderstanding" on this issue (and it ain't mine!).”HM

Genomic DNA v. transposons.Better?

DNA as a rule does not jump. Transposons do because of particular properties of their sequence. Transposons are made of DNA but not all DNA is equivalent to a transposon.TTFN,WK