Understanding through Discussion


Welcome! You are not logged in. [ Login ]
EvC Forum active members: 88 (8890 total)
Current session began: 
Page Loaded: 02-17-2019 6:02 PM
155 online now:
candle2, DrJones*, marc9000, Tangle, Theodoric (5 members, 150 visitors)
Chatting now:  Chat room empty
Newest Member: WookieeB
Post Volume:
Total: 847,611 Year: 2,648/19,786 Month: 730/1,918 Week: 17/301 Day: 17/38 Hour: 0/4


Thread  Details

Email This Thread
Newer Topic | Older Topic
  
Prev123
4
567Next
Author Topic:   How well do we understand DNA?
crashfrog
Inactive Member


Message 46 of 98 (182562)
02-02-2005 12:18 PM
Reply to: Message 42 by TheLiteralist
02-02-2005 2:23 AM


Re: Mechanism?
If there is, wouldn't you say that we could possibly be calling things random mutations, when in fact they are "on-purpose mistakes."

There's no difference, though. I think maybe you don't quite understand what we mean by "random mutation." "Random" doesn't refer to purpose, it refers to the outcome of the mutation, which is unpredictable. And of course "mutation" simply refers to genetic changes that occur as a result of imperfect copying or repair.

An "on-purpose mistake" would still be a random mutation, because the change would be a mutation, and its outcome would be random.


This message is a reply to:
 Message 42 by TheLiteralist, posted 02-02-2005 2:23 AM TheLiteralist has not yet responded

  
JonF
Member
Posts: 4467
Joined: 06-23-2003
Member Rating: 3.6


Message 47 of 98 (182568)
02-02-2005 12:39 PM
Reply to: Message 42 by TheLiteralist
02-02-2005 2:23 AM


Re: Mechanism?
If there is, wouldn't you say that we could possibly be calling things random mutations, when in fact they are "on-purpose mistakes.

The Luria-Delbruck experiments in 1943 pretty much killed that idea. Mutations are the cause of most variation, and are not generated by need. {Added in edit: by "not generated by need" I mean they are not generated to meet a particular need; some organisms do have wasy of generating more mutations when they need them, but the mutations themselves are random with regard to their effect.}

Bacterial Mutations: Luria and Delbruck Hit the Jackpot (1943)
The Luria & Delbruck Fluctuation Test.

This message has been edited by JonF, 02-02-2005 12:42 AM


This message is a reply to:
 Message 42 by TheLiteralist, posted 02-02-2005 2:23 AM TheLiteralist has responded

Replies to this message:
 Message 48 by crashfrog, posted 02-02-2005 1:17 PM JonF has not yet responded
 Message 50 by TheLiteralist, posted 02-02-2005 1:50 PM JonF has not yet responded

  
crashfrog
Inactive Member


Message 48 of 98 (182573)
02-02-2005 1:17 PM
Reply to: Message 47 by JonF
02-02-2005 12:39 PM


Re: Mechanism?
The Luria-Delbruck experiments in 1943 pretty much killed that idea. Mutations are the cause of most variation, and are not generated by need.

I don't think he's proposing that; I think he's saying that because the mutation occured "on-purpose", that is a mechanism allowed or stimulated a mutation (but not the outcome of the mutation), the mutation was not "random".

I disagree because that's not why we call them random. We call them random because the outcome of the mutation event is not deterministic; in that sense there's no difference between what he proposes and what we term "random mutation."


This message is a reply to:
 Message 47 by JonF, posted 02-02-2005 12:39 PM JonF has not yet responded

Replies to this message:
 Message 51 by TheLiteralist, posted 02-02-2005 2:06 PM crashfrog has responded

  
Ooook!
Member (Idle past 3859 days)
Posts: 340
From: London, UK
Joined: 09-29-2003


Message 49 of 98 (182576)
02-02-2005 1:20 PM
Reply to: Message 37 by TheLiteralist
01-31-2005 4:52 PM


Hi T.Lit.

I’ve been meaning to get involved in this topic in a while, and I keep on forgetting – drat!
Although LM, Q and WK (and others) have been fairly comprehensive in their comments (and have done a much better job than I would have done :o), can I make a couple of comments regarding using this

The t-cells or b-cells (or some kind of cells) can do some neat DNA shuffling just to try out different binding sites

as a workable model for an intelligent driving force behind mutation?

1) As far as I remember the DNA rearrangements which occur in B-cells (and T-cells) are permanent events. A potential B-cell which is not fully differentiated has the potential to make all of the different possible combinations (this is why you do get such a variety of antibodies). Once the cell has matured however, the other possible sequences have been excised from the genome – there is no going back. From what I can gather about Behe’s ideas, this is not incompatible with a super-dooper multi-fate Ur-cell at the beginning of evolution, which contained all of the information required for life. As a working model this doesn’t work for me. The first cell would not only have to contain DNA code needed to make a human, but also to make a crocodile, a banana, a fir tree and everything else on earth – that’s one hell of a cell!!

2) I don’t know if you’re aware, but B-cells also undergo what is known as somatic hypermutation, whereby the piece of DNA which encodes the binding site of the antibody is very prone to DNA copying mistakes. It’s not fully understood how this hypermutation occurs but it has something to do with the recruitment of a defective DNA repair process to those areas. This seems to be the kind of mechanism you are proposing with your ‘intelligent programmer’ scenario, where mistakes are encouraged in certain areas and not others. I won’t labour this point because others have already mentioned it, but this is an important crutch of the ID movement that intelligence is detectable. This kind of mechanism is well within the reaches of random mutation and selection so how would you detect the hand of a designer/programmer in your theoretical model?

Hope all that wasn’t too garbled :D


This message is a reply to:
 Message 37 by TheLiteralist, posted 01-31-2005 4:52 PM TheLiteralist has responded

Replies to this message:
 Message 53 by TheLiteralist, posted 02-02-2005 2:35 PM Ooook! has responded

    
TheLiteralist
Inactive Member


Message 50 of 98 (182587)
02-02-2005 1:50 PM
Reply to: Message 47 by JonF
02-02-2005 12:39 PM


Changing due to Need
Hi JonF,

I think I am having a time communicating my thought clearly, and I think that it would be easy to read what I've written and think that I am talking about variation being generated in response to need, almost like foresight.

However, this isn't what I'm proposing. I shall try to make my point even clearer in a later post.

Thanks,
--TL


This message is a reply to:
 Message 47 by JonF, posted 02-02-2005 12:39 PM JonF has not yet responded

  
TheLiteralist
Inactive Member


Message 51 of 98 (182589)
02-02-2005 2:06 PM
Reply to: Message 48 by crashfrog
02-02-2005 1:17 PM


RANDOM and MUTATION
Hi CrashFrog,

I don't think he's proposing that; I think he's saying that because the mutation occured "on-purpose", that is a mechanism allowed or stimulated a mutation (but not the outcome of the mutation), the mutation was not "random".

I disagree because that's not why we call them random. We call them random because the outcome of the mutation event is not deterministic; in that sense there's no difference between what he proposes and what we term "random mutation."

You are almost right, I think. At the beginning I asked how could we tell the difference between what I am proposing and what is now called random mutations. The distinction would not be easy, and may not be possible at all.

You are slightly off in that, in my mind at least, what I am considering IS random in a way. The mechanism, whatever it may be, would control where the "sloppy on purpose" would occur, it might control the extent of the "sloppiness", and it might control when the "sloppiness" occurs (but all three things could be made to be random to some degree, in my mind at least, based on some computer programming I've done, tho I'm not sure that the DNA/programming analogy can be carried that far--it seems capable of such controlled randomness, tho, e.g., the immune system).

The main point is that WHERE and HOW the sloppiness occurs is somewhat controlled and would, therefore, be limited to what changes could takes place due to THIS mechanism.

My main problem is with the term MUTATION, which, I suppose could just mean change, but it has, for me at least (and I could be wrong), a connotation that it is a change that is either an unintended change caused by an error of the cell during replication or a change caused by some external factor such as radiation. I believe these things can and do happen, but that they would have mostly, if not only, deleterious effects since they would not be built into the function of the cell.

I appreciate your examination of the "model." Particularly your last post to which this post responds. I shouldn't be surprised if it is way off-base for one reason or another.

--TL

This message has been edited by TheLiteralist, 02-02-2005 14:07 AM


This message is a reply to:
 Message 48 by crashfrog, posted 02-02-2005 1:17 PM crashfrog has responded

Replies to this message:
 Message 54 by Loudmouth, posted 02-02-2005 2:50 PM TheLiteralist has not yet responded
 Message 55 by crashfrog, posted 02-02-2005 2:59 PM TheLiteralist has responded

  
pink sasquatch
Member (Idle past 4067 days)
Posts: 1567
Joined: 06-10-2004


Message 52 of 98 (182593)
02-02-2005 2:14 PM
Reply to: Message 37 by TheLiteralist
01-31-2005 4:52 PM


Non-random mutation can drive evolution... and disease.
Hi TL,

I've been meaning to jump into this thread for awhile - earlier you proposed:

The code would not cause variation just anywhere or everywhere but would target only certain areas... Random mutations could occur anywhere or everywhere, but I am proposing that truly random mutations (actual copying errors, radiation, etc.) would be useless or, most likely, harmful in some way and would quickly be selected out--perhaps ending with mutant organism itself.

In one sense you may be correct, because mutation is not truly random, because the DNA sequence itself is not random. DNA repair machinery has an especially difficult time with repetitive sequence; in other words:

AGAGAGAGAGAGAGAGAGAGAGAGAGAGAG

is much more likely to undergo a mutational event than:

ATCGTACGGGCTAATGCTAGCTTCTAAGCCG

due to a distinct form of mutation caused by mispairing of the repetitive sequence. Repetitive sequence mutations by such mispairing may occur up to 100,000 times more often than point mutations, and as such, repetitive sequence has long been a source of polymorphisms ('markers') for genetic mapping studies.

Recently a paper was published providing evidence that mutations in such repetitive sequences provide a molecular basis for rapid evolution of certain characteristics:

Proc Natl Acad Sci U S A. 2004 Dec 28;101(52):18058-63. Epub 2004 Dec 13.

Molecular origins of rapid and continuous morphological evolution.

Fondon JW 3rd, Garner HR.

Mutations in cis-regulatory sequences have been implicated as being the predominant source of variation in morphological evolution. We offer a hypothesis that gene-associated tandem repeat expansions and contractions are a major source of phenotypic variation in evolution. Here, we describe a comparative genomic study of repetitive elements in developmental genes of 92 breeds of dogs. We find evidence for selection for divergence at coding repeat loci in the form of both elevated purity and extensive length polymorphism among different breeds. Variations in the number of repeats in the coding regions of the Alx-4 (aristaless-like 4) and Runx-2 (runt-related transcription factor 2) genes were quantitatively associated with significant differences in limb and skull morphology. We identified similar repeat length variation in the coding repeats of Runx-2, Twist, and Dlx-2 in several other species. The high frequency and incremental effects of repeat length mutations provide molecular explanations for swift, yet topologically conservative morphological evolution.

PMID: 15596718

But the other side of the high rate of repetitive sequence mutation needs to be considered as well - such mutations also contribute to disease, especially cancer. Hereditary non-polyposis colon cancer is a familial form of cancer that typically progresses via loss of the tumor suppressor gene Transforming growth factor beta receptor II - the tumor suppressor is lost by mutation of a repetitive sequence.

So, as many others have pointed out to you, even though exceptions to the concept of "random mutation" exist, there is no reason to believe that the exceptions are the result of intelligent design.

In the case of repetitive sequence mutation, we have to ask ourselves why an intelligent designer would put the same repeats into important disease suppressor genes as in regulatory elements that could drive evolution.

Hopefully that all made sense - let me know if you need further explanation.


This message is a reply to:
 Message 37 by TheLiteralist, posted 01-31-2005 4:52 PM TheLiteralist has responded

Replies to this message:
 Message 57 by TheLiteralist, posted 02-02-2005 3:06 PM pink sasquatch has responded

  
TheLiteralist
Inactive Member


Message 53 of 98 (182599)
02-02-2005 2:35 PM
Reply to: Message 49 by Ooook!
02-02-2005 1:20 PM


The All-Encompassing First Cell
Hi Oook,

I don't hold to the first-cell-with-all-the-info-for-everything model that Behe proposes. That is truly a bizarre proposal to me. I seem to recall reading his whole book thinking he was a creationists until I got to the end, and went "WHAT?!?"

But I think the idea of irreduceable complexity has much merit (though I'm aware evos don't). I also just enjoyed reading about the various biological processes he outlines in his book--such as a general overview of how the immune system can introduce "sloppyness on purpose" to produce random binding sites.

Reading of that process inspired this "model" of mine, but I don't see any connection between this model and irreducible complexity (maybe a slight connection to that one) or the first-cell-that-had-info-for-everything (especially not that one!)

Really, if the issue of intelligent design or evolution etc. could be laid to the side temporarily, I'd like someone to try to honestly see if the idea has any merit at all.

Is there a mechanism within the cell or DNA that is "intentionally" (for lack of a better word) producing random changes in certain areas of the DNA. I don't mean actual copying errors, where the cell meant to make a perfect copy and made an imperfect one, but intentional changes (which might look too much like legitimate copying errors to ever tell the difference). Would there even be a way to make this distinction???

It’s not fully understood how this hypermutation occurs but it has something to do with the recruitment of a defective DNA repair process to those areas. This seems to be the kind of mechanism you are proposing with your ‘intelligent programmer’ scenario, where mistakes are encouraged in certain areas and not others.

Yes, you are right, I think that is what I am trying to propose. In light of this comment, it may not be possible to even tell the difference between actuall copying errors and those induced on purpose for variation's sake. Plus I see here the word "mutations" being used even when the system is doing it on purpose, so to speak.

So really, CrashFrog is almost completely right in saying there is no difference...except that my "mechanism" (as I'm proposing it) would not affect just anywhere in the genome, but would likely not affect certain core areas of the genome.

I guess another inspiration for this idea is what appears to be the fact that bacteria and algae apparently variate tremendously. So much so, that I am becoming amazed that there is not some process to keep them stable enough that we can still classify them over the past century. If the randomization process is controlled to some extent by the DNA, that would make sense to me. The variants are only able to variate in certain ways and not in others. (I'm not saying I'm right...that's just the "model" I'm proposing).

Oh well, thanks for the response Oook!
--TL


This message is a reply to:
 Message 49 by Ooook!, posted 02-02-2005 1:20 PM Ooook! has responded

Replies to this message:
 Message 56 by crashfrog, posted 02-02-2005 3:05 PM TheLiteralist has responded
 Message 88 by Ooook!, posted 02-08-2005 8:03 AM TheLiteralist has not yet responded

  
Loudmouth
Inactive Member


Message 54 of 98 (182604)
02-02-2005 2:50 PM
Reply to: Message 51 by TheLiteralist
02-02-2005 2:06 PM


Re: RANDOM and MUTATION
quote:
You are almost right, I think. At the beginning I asked how could we tell the difference between what I am proposing and what is now called random mutations. The distinction would not be easy, and may not be possible at all.

From current observations I think it would be impossible to determine the root of randomness with respect to mutations. As an analogy, let's pretend that there are two separate throws of two dice each (ie craps). From the outcome of the roll, could we determine if the roller was human or if the dice merely fell off of a shelf? I don't think we could. This is the same thing that we see in random mutations. Are mutations due to a preset condition or was it due to the selective advantage of having slightly sloppy DNA replication/repair mechanisms? Until there is separate evidence of an Intelligent Designer, we have to go with the observations that we have at hand, namely the mechanisms of mutation and natural selection.

quote:
The main point is that WHERE and HOW the sloppiness occurs is somewhat controlled and would, therefore, be limited to what changes could takes place due to THIS mechanism.

The "sloppiness" is controlled by the DNA sequence that codes for the proteins involved in DNA repair and replication. Therefore, these replication and repair systems are susceptible to mutation and natural selection as well.

What "could take place" is random, much like the outcome of a roll of dice. Even if I intend to roll a pair of dice, that intention does not make the outcome non-random. Again, as noted above, we simply can't start with the outcome and look back at intention unless we can specifically observe that intention. For ID, this is a problem since we have no observations that would allow us to ascribe intention to a Designer. For evolution, we do have intention, the survival of the species.


This message is a reply to:
 Message 51 by TheLiteralist, posted 02-02-2005 2:06 PM TheLiteralist has not yet responded

  
crashfrog
Inactive Member


Message 55 of 98 (182605)
02-02-2005 2:59 PM
Reply to: Message 51 by TheLiteralist
02-02-2005 2:06 PM


Re: RANDOM and MUTATION
At the beginning I asked how could we tell the difference between what I am proposing and what is now called random mutations. The distinction would not be easy, and may not be possible at all.

If it's not possible, then what's the difference?

It may not be possible to tell the difference between gravity and another, previously unknown form of energy that I propose is what holds me, specifically (and not you), down onto my seat; but if it's not, what's the difference?

The main point is that WHERE and HOW the sloppiness occurs is somewhat controlled

Random mutation is somewhat controlled, by the cellular machinery that alread exists to repair genetic damage. Again, no difference between what you're proposing and what we already know provides the source of all genetic variation.

My main problem is with the term MUTATION, which, I suppose could just mean change, but it has, for me at least (and I could be wrong), a connotation that it is a change that is either an unintended change caused by an error of the cell during replication or a change caused by some external factor such as radiation.

The changes you're talking about aren't built into the cell, either. Under your proposal, the mechanism of the actual change is still copying errors or exterior mutagens. Your proposal is that cellular mechanisms exist that allow these exterior factors to exert greater effect; in a sense, that the DNA is left "exposed" to these mutations to a greater extent than normal as a specific cell response.

What we're telling you is that this is already known to occur, and that its called "random mutation."

The changes you're talking about in your model are still caused by copying errors and external mutagens, or else they would be deterministic changes, which you say that they are not. How else would a cell generate a random outcome?

I believe these things can and do happen, but that they would have mostly, if not only, deleterious effects since they would not be built into the function of the cell.

Again, we know this to be false. Random mutations have mostly no effect. Few are deleterious, and even fewer still are beneficial. Which is why mutation, for the large part, is restricted by cellular machinery.

I shouldn't be surprised if it is way off-base for one reason or another.

I think what you should be surprised about is how your model is exactly like the model you're trying to pit it against. You're quite on-base with your model; it's exactly what we find in nature, which is called "random mutation."


This message is a reply to:
 Message 51 by TheLiteralist, posted 02-02-2005 2:06 PM TheLiteralist has responded

Replies to this message:
 Message 59 by TheLiteralist, posted 02-02-2005 3:20 PM crashfrog has not yet responded

  
crashfrog
Inactive Member


Message 56 of 98 (182609)
02-02-2005 3:05 PM
Reply to: Message 53 by TheLiteralist
02-02-2005 2:35 PM


Re: The All-Encompassing First Cell
Plus I see here the word "mutations" being used even when the system is doing it on purpose, so to speak.

Purpose has nothing to do with mutation. Mutations are random not in that they're without purpose, but that the outcome of a mutation "event" is not determined by environment.

Do you see, yet? We say that the lottery is random, because the outcome is not determined. (That would be fraud.) Yet, people don't play the lottery "randomly", or without purpose; they play for the purpose of gettin' paid.

That doesn't make the lottery less random. You're conflating two meanings of the word "random": "nondetermined" and "without purpose."

So really, CrashFrog is almost completely right in saying there is no difference...except that my "mechanism" (as I'm proposing it) would not affect just anywhere in the genome, but would likely not affect certain core areas of the genome.

Again, no difference from random mutation as observed in nature, where certain genetic loci are known to mutate more frequently than others, though no segment of DNA is able to be completely shielded from mutation.

The variants are only able to variate in certain ways and not in others.

Wait, now, you're backtracking. To variate not in certain ways means that some genetic changes are somehow disallowed; or that certain segments of DNA are not allowed to change.

But you already agreed that you're not proposing this in your model. Which is it, exactly?


This message is a reply to:
 Message 53 by TheLiteralist, posted 02-02-2005 2:35 PM TheLiteralist has responded

Replies to this message:
 Message 60 by TheLiteralist, posted 02-02-2005 3:30 PM crashfrog has responded

  
TheLiteralist
Inactive Member


Message 57 of 98 (182610)
02-02-2005 3:06 PM
Reply to: Message 52 by pink sasquatch
02-02-2005 2:14 PM


Re: Non-random mutation can drive evolution... and disease.
Pink Sasquatch,

Tremendous!

I think this is better than my fuzzy "mechanism." Could this fact that copying errors are inherent in certain sequences where there is a lot of repetitiveness be the mechanism I'm looking for? Do all or most traits that vary have this quality of highly repetitive sequences? Are there other mechanisms that work like this?

In the case of repetitive sequence mutation, we have to ask ourselves why an intelligent designer would put the same repeats into important disease suppressor genes as in regulatory elements that could drive evolution.

I understand this. I really do. As far as the Creator making things like cancer and such, the Creator that I follow (the God of the Bible) has made it clear that He has created both health and sickness and that since sin has entered the world death and suffering are the lot of humanity in general in this life. While I'm not enjoying living in a world of suffering, it would be different if the Bible made it sound like all was well with the world...then I might have a different reaction to your question.

Let us not forget that some things the Creator is not responsible for (particularly in "civilized" nations): the effects of junk food, enriched-white bread, vaccines, soda pop, pollution, sewage waste brought about by the adoption of indoor plumbing, nuclear waste, etc.

A tremendous post PS, thanks.
--TL


This message is a reply to:
 Message 52 by pink sasquatch, posted 02-02-2005 2:14 PM pink sasquatch has responded

Replies to this message:
 Message 58 by crashfrog, posted 02-02-2005 3:16 PM TheLiteralist has responded
 Message 62 by pink sasquatch, posted 02-02-2005 3:44 PM TheLiteralist has responded

  
crashfrog
Inactive Member


Message 58 of 98 (182613)
02-02-2005 3:16 PM
Reply to: Message 57 by TheLiteralist
02-02-2005 3:06 PM


Could this fact that copying errors are inherent in certain sequences where there is a lot of repetitiveness be the mechanism I'm looking for?

I'm not trying to agree or disagree in this post, but I myself had a hard time understanding the relationship between repetitive sequences and mutation until I saw diagrams of it. So maybe you would find the same thing helpful.

Repetitive sequences are vulnerable to something called "slipped-strand mutation", which can be both additive or subtractive to the genetic material based on the direction of the slippage:


This message is a reply to:
 Message 57 by TheLiteralist, posted 02-02-2005 3:06 PM TheLiteralist has responded

Replies to this message:
 Message 61 by TheLiteralist, posted 02-02-2005 3:34 PM crashfrog has responded

  
TheLiteralist
Inactive Member


Message 59 of 98 (182614)
02-02-2005 3:20 PM
Reply to: Message 55 by crashfrog
02-02-2005 2:59 PM


gravity analogy
CF,

It may not be possible to tell the difference between gravity and another, previously unknown form of energy that I propose is what holds me, specifically (and not you), down onto my seat; but if it's not, what's the difference?

I guess what I'm wondering would be like seeing some people down and some people floating. Some might be either way on any given day. But some people would always be down. In this case, the theory of gravity would need some tweaking.

So, are there any segments, in any particular organism, that are known not to mutate or that mutate only with extreme rarity, and when they do the organism is debiltated in some way? That would be an important question for this discussion I think.

PS has already indicated that certain segments are much more likely to mutate, which seems to be sort of what I had in mind.


This message is a reply to:
 Message 55 by crashfrog, posted 02-02-2005 2:59 PM crashfrog has not yet responded

  
TheLiteralist
Inactive Member


Message 60 of 98 (182617)
02-02-2005 3:30 PM
Reply to: Message 56 by crashfrog
02-02-2005 3:05 PM


MUTATIONS
CF,

When I said...

Plus I see here the word "mutations" being used even when the system is doing it on purpose, so to speak.

I meant that my problem with the term "mutations" has been unwarranted. It just means "change," which my model proposes.

My model propose random changes in the DNA sequence. So, it is proposing random mutations--though I've been hard-headed about it.

The difference as far as I can see then is that I am proposing that most changes are due to the construction of the code, which is, as PS posted, also recognized already.

I am then curious about two things: (1) are certain segments in any given genome strangely much less likely to have a random mutation and (2) are there any other code-cause mutation mechanisms such as posted by PS?

Along with the first question, I am also curious if it is known, about any particular genomes, that if these segments that are far less likely to mutate (should they exist) also just happen to be the ones that should a mutation occur have deleterious effects on the resultant organism?

--TL


This message is a reply to:
 Message 56 by crashfrog, posted 02-02-2005 3:05 PM crashfrog has responded

Replies to this message:
 Message 66 by crashfrog, posted 02-02-2005 3:59 PM TheLiteralist has responded

  
Prev123
4
567Next
Newer Topic | Older Topic
Jump to:


Copyright 2001-2018 by EvC Forum, All Rights Reserved

™ Version 4.0 Beta
Innovative software from Qwixotic © 2019