4 online now:	kjsimons, PaulK, Phat, Tangle
Newest Member:	ChatGPT
Post Volume:	Total: 916,911 Year: 4,168/9,624 Month: 1,039/974 Week: 366/286 Day: 9/13 Hour: 1/1

EvC Forum ⇒ Science Forums ⇒ Intelligent Design ⇒ What exactly is ID? ⇒ Message 102 ⇒

Peek

Internal Message Text

Author:		Smooth Operator
Message:		102

Forum:		Intelligent Design
Topic:		What exactly is ID?
Subtitle:		Re: Flaws of ID

[quote]Yes, it is like saying that because anyone who talks about 'a sequence that codes for an eye' is essentially saying 'I don't understand developmental biology' in the same way your statement shows that you don't have a coherent understanding of genetic information.[/quote]Am I supposed to copy/paste individual sequences to you so you would understand what I'm talking about?

TACCCCGTAGAGGTGCGCTTCACCCGAGGCGATGACATTCTGCTGAGCCCC
TACCTGGTGGGGGTACGCTTCACCTGGAG-GATGACATCCTACTGAGCCCC

The first sequence is a rat's active GULO gene sequence. The lower one is a human one. The human one is different and is unable to synthesize Vitamin C. Threfore, the information was reduced, becasue the function of synthesizin vitamin C is lost.

[quote]It affects it when the HBs forms polymers, but the actual individual haemoglobin molecules retain their normal binding affinity (Bonaventure et al., 1999. [/quote]Loss in polymer affinity is enough to say it's a loss.

[quote]This is what I'm talking about, you make a totally subjective judgement call that undercuts the validity of your whole approach. You are totally divorcing the concept of biological information from what we identify inc complex evolved systems, it isn't a question simply of having some form of molecular function, it is about wider biological function in terms onf environmental interactions, which resistance to amlaria would certainly qualify as.[/quote]Well than you simply have a wrong definition of a biological function. If you are going to equate the workings of a flagellum with an inability of malaria to infect the body, be my guest, but that approach is invalid.

It's like equating the working of a HDD with a broken HDD and claiming that borken HDD has gained a new function. And the new function is the resistance of viruses it could have caught over the internet.

[quote]As to looking at nucleotide changes to quantify the loss, this is no answer at all, you could have just as many changes with no effect on function whatsoever.[/quote]Which just means there was no loss. Where seems to be the problem? If you change the sequence and you find there was no loss of function, than that means that the amount of information remains the same.

[quote]I'm quite happy to accept that the mitochondrial genomes of larger mammals with small effective population sizes may be subject to genetic meltdown. What I dispute, and this paper does nothing to support, is the contention that this is a universal trend in all genomes, or even all vertebrate genomes. The paper certainly doesn't demonstrate the inevitability of genetic entropy leading to extinction.[/quote]Of course it doesn't, becasue it's not supposed to. I need you to extrapolate on that a bit. If you throw a rock in a lake, it's going to make waves. If you throw it in an ocean, it's probably going to make waves also.

No matter the population, the effect is the same, you just need to extrapolate it. No genome is special, they are all based on the same basic principle. If one species is shown to deteriorate, than there is no reason to think millions of other species are not going to. My question to you is, why do you think other genomes are so special that they would not deteriorate over time?

[quote]I see that you still don't understand that graph, it doesn't say anything about changing the accumulation of mutations, it talks about the difference epistatic effects have on the fitness effects of cumulative mutations. The point is that the steep drop off in the negative synergistic epistasis line means that the accumulation of only a few mutations will produce a non-linear change in fitness and consequently a non-linear change in selective pressure against the carrier.[/quote]Which means that less mutations will accumulate in the population. Still, the obvious drop in fitness is obvious. I know what the graph shows. It shows that with the larger numbers of mutations, the synergistic epistasis model is more efficient.

Now again, I need you to extrapolate. If we clearly know that all individuals are mutants with deleterious mutations, and we include synergistic epistasis as the model of natural selection that is in operation, it will simply mean that mutations accumulate. Yes, at a very much slower pace, but they still accumulate.

[quote]This is the sort of vague definition I am talking about. This doesn't tell us how to measure information at all. All it does is let us identify the extreme case where the gene completely loses its function. Have you settled on the Hazen/Szostak form of 'functional information', if so you should bear in mind the limitations they themselves identify with their approach.[/quote]I am not using their definition, and as I already told you, I never was. I simply argued that it existed, that is all.

My preference was always Dembski's CSI. Which is obviously quantifiable. If we have a, let's say a flagellum that is coded for with 800 bit sequence. Now I know there is a lot more bits needed to code for a flagellum, which is actually 4,639,221 base pair long, but I'm making it easier to understand.

So, we have this 800 bit sequence, we also denote it as a: "bidirectional rotary motor-driven propeller". Becasue that is the patternt it maches, which makes it specified, and also since it is more than 400 bits long, it constitutes complex specified information - CSI.

Now we notice mutations that makes a part less functional, or even removes it, such as if the pattern that still works, is now described as: "bidirectional rotor", which would imply that it lost it's tail.

We would than simply count the remaining base pairs, which describe this remaining pattern, and conclude that, let's say 750 bits of information code for the remaining parts. This means that 50 bits of information are lost.

Home

All Forums

All Topics

Do Nothing Button