What about those jumping genes?

molbiogirl, you wrote: You and crashfrog seem to be astute in this business of HGT. I am neither astute nor in the business, but I read enough about it to be dangerous (at least to my own credibility). I have been reading Frederic Bushman's Lateral DNA Transfer/Mechanisms and Consequences (2002), in which he asserts "Our own DNA is a complex composite of imported sequences and mobile genetic parasites..." (p. xiii), and he speaks of "genes floating on a sea of retrotransposons" (pp. 239-275). Boy, does that ignite my imagination!Bushman uses the term "lateral DNA transfer" instead of HGT. Have either of you read his works? He appears to be a leader in this area at the Salk Institute.In Chapter 19 of his book he pursues the question: "DNA Transposons of Eukaryotes: Mariners Sailing to Survive?" In that pursuit he observes (p. 282): "Consider the cecropia family of Tc1/mariner elements, named for the giant silk worm moth Hyalophora cecropia, in which the first family member was found (Fig. 9.7) [see below]. Members of this family have been found in insects, flatworms, a hydra, and humans." "Figure 9.7. Sequence relationship among mariner elements of the cecropia subfamily. Note that a human element clusters with several insects, whereas a prosimian sequence clusters in a different part of the tree with other insects." (p. 282)I don't know, crash and molbiogirl, those bug genes look pretty jumpy to me.”HM

All very interesting about TEs.Molbiogirl, a question for you: Do you think it is reasonable to suppose that the bite of a tsetse fly, or many, could introduce enough fly genes via its saliva to find their way to a human male's testicle and become directly incorporated into his DNA somehow in a meiotic fluke (perhaps in the first prophase where crossing-over happens)? Just how much do TEs and other genes jump around?”HM

molbiogirl wrote: I seriously doubt that. How do you suppose it's possible to do a DNA analysis on a licked and sealed envelop? Not true! A tsetse fly's saliva has a lot of genes in it, usually including those of trypanosomes and other parasites.”HM

WK wrote: You're right. For that to occur in a heritable way the transfer would have to extend all the way into meiosis (for many eukaryotes, at least).”HM

The National Institutes of Health would disagree. Check out this article on Saliva: Your Spitting Image:

quote:

---

When you lick that envelope, you may be sending a more detailed message than you realize. Your saliva leaves a DNA fingerprint that not only says who you are, but also whether you have a genetic predisposition for certain diseases.

---

Are you sure? If human genes are found in human saliva why can't tsetse-fly genes be found in tsetse-fly saliva?”HM

molbiogirl wrote: But why would the National Institutes of Health say this? When you lick that envelope, you may be sending a more detailed message than you realize. Your saliva leaves a DNA fingerprint that not only says who you are, but also whether you have a genetic predisposition for certain diseases.That's a "DNA fingerprint." They're not talking about proteins here.”HM

molbiogirl, you wrote: Yes, and...? Why not? What principle in molecular biology prohibits tsetse-fly DNA from appearing in tsetse-fly spit? I'll be right back to you on that as soon as I get a PhD in molecular biology. But, hey, stranger things have happened.”HM

Why not? All they have to do is get involved with meiosis and gametes. Blood-borne tsetse-fly genes might not be much different from the "imported sequences and mobile genetic parasites" that Frederic Bushman speaks of down at The Salk Institute. And he seems to be an expert on transposons.”HM

molbiogirl wrote: Who's "wiki"? Wikipedia is not an authoritative source for this discussion. Did you even bother to read what Frederic Bushman said, quoted in Message 44? No. You haven't explained yet how: "Our own DNA is a complex composite of imported sequences and mobile genetic parasites" (F. Bushman). You can't tell me how those mobile genetic parasites got into our DNA complex. You're saying it can't happen. But it did. Do you know more about this than Bushman does?”HM

WK wrote: OK. Then genes can hop onto those cabooses of terminal sequences. That's one way a gene can jump on board. It seems to me that your references help me make to my case.”HM

molbiogirl wrote: OK, molbiogirl, you have pretty much won this argument. But bear in mind that protists take DNA into their cells as part of their ingested food. In those cases "ordinary genomic DNA" is allowed entry into the cell without such "regulation." Wouldn't that leave open the possibility of undigested fugitive genomic DNA running loose and wild inside the plasma membrane of a paramecium?”HM

WK responded to my statement: Well, let me see if I have this right. You, along with molbiogirl, are saying that "just the known factors such as retroviral insertion and transposase activity" can account for Bushman's "complex composite of imported sequences and mobile genetic parasites." And yet you are also saying that same said genetic sequences and parasites could not have come from tsetse flies.Why not? Where, then, did they come from? I'm not looking for magical insertions. They must have physical origins. And where do all those introns come from? I doubt that they came from copying errors and mutations alone; some of them must have come from other organisms. Why not tsetse flies? It seems possible to me that some constantly bitten Africans could have sustained levels of tsetse-fly saliva in their bloodstream, possibly carrying tsetse-fly DNA, which circulates right through the human host's reproductive organs and tissues. The rest of the trip into the human genome was then facilitated by the TE chemistry you and mbg have so ellegantly narrated.Please tell me why your own selected reference does not support my argument: ”HM

WK wrote: You and molbiogirl make strong arguments about the "chemicality" of genes, if I may be so crude. TEs have to take chemical steps 1 thru 5 to get anywhere, as mbg asserts. In your cited reference, Glossina palpalis Tsetse.fly.3 mariner transposase gene, partial cds, this sequence of the "tsetse-fly 3 mariner transposon" is reported :

quote:

---

GAACGAGAATCAAAAAAATCGCCGTTTTGAAGTATCGTCCTCTCTCCTTTTGCGCAACAACGAC
GATCCATTTCTTAACCGGATTGTGACATGCGATGAAAAGTGGATTCTTTACGACAATCGGCGGC
GGTCGGCACAGTGGTTAGACGCTGATGAAGCTCCACAACACTTCCCCAAGCCCAAACTCCACCA
AAAGAAGATCATGGTGACTGTTTGGTGGTCAGCAGTAGGTTTGATACACCACAGCTTCCTGAAT
CCGGGCGAAACCATTACAGCCGAGAAGTATTGTCAACAAATCGACGAGATGCACCAGAGGCTTC
AACAAAAACAGCCGGCATTGGTCAACAGAAAAGGCCCAATTCTCCTACATGATAACGCACGACC
ACACGTTTCAATGATCACGCGACAAAAGCTGTATGAGTTGGGTTATGAAACTCTCGATCACCCA
CCA

---

What we have here is a digital encryption of said same transposon. It is the "digitality" of genes that fascinates me and ignites my imagination about how they can morph and leap around amongst populations as "pure information" (Dawkins). Because of this kind of "infostructure," if you will, I want to see genetic careers in transposition as engaging more than mere chemical reactions, which are only perfunctory. (Ringo will snort about this, I know.)What I see is a gambetto of macromolecular codes that have extraordinary talents for structural creativity and mobility. Biological evolution is entirely dependent upon these digital codes for encrypting and communicating structural information by way of the nucleotides in those macromolecules. Nowehere else in nature do such things happen. Rocks are not so well informed. It's all about the code; there's nothing very special about the digital nucleotides A,C,T, and G or the atoms they comprise.Genes jump because they are pure information”"lighter than molecular air"”not because DNA molecules have strong legs and sticky feet.”HM

molbiogirrl writes: mbg, are you saying this helps your argument? Seems to me, then, that 45% of the human genome is in a state of transposition. What you are saying, in effect, is that the human genome is a pluarity of jumping genes. Would it make any difference to the human genome if those jumping genes were to migrate somewhere else?”HM

WK asks: Yes, here's a method: When one human organism orders a gene over the Internet he/she may specify to another human organism that specifc gene in digital code, such as:

quote:

---

GAACGAGAATCAAAAAAATCGCCGTTTTGAAGTATCGTCCTCTCTCCTTTTGCGCAACAACGAC
GATCCATTTCTTAACCGGATTGTGACATGCGATGAAAAGTGGATTCTTTACGACAATCGGCGGC
GGTCGGCACAGTGGTTAGACGCTGATGAAGCTCCACAACACTTCCCCAAGCCCAAACTCCACCA
AAAGAAGATCATGGTGACTGTTTGGTGGTCAGCAGTAGGTTTGATACACCACAGCTTCCTGAAT
CCGGGCGAAACCATTACAGCCGAGAAGTATTGTCAACAAATCGACGAGATGCACCAGAGGCTTC
AACAAAAACAGCCGGCATTGGTCAACAGAAAAGGCCCAATTCTCCTACATGATAACGCACGACC
ACACGTTTCAATGATCACGCGACAAAAGCTGTATGAGTTGGGTTATGAAACTCTCGATCACCCA
CCA

---

No molecular medium is required (other than human brains and computers, I suppose) to communicate this genetic information...ah, but "spurious appeals to quantum physics made by the purveyors of woo to support any ludicrous claim they fancy" notwithstanding.Love that woo!”HM