Abiogenesis

What do you think the phrase "genetic encryption process" (zero hits on google) even means? Yeah, me too.No-one supposes that the genome is made out of "nothing".---You might find the following article interesting: Evidence for de novo production of self-replicating and environmentally adapted RNA structures by bacteriophage Qbeta replicase.Yup, it's abiogenesis in a test-tube, such fun.Edited by Dr Adequate, : No reason given.Edited by Dr Adequate, : No reason given.Edited by Dr Adequate, : No reason given.

simple rob. your claim that abiogenesis couldn't happen because DNA/RNA needs a whole lot of things for replication.If you can replicate it simply and easily, then you understand a single step of how life can hang on. Because if there is no replication process, then the first DNA/RNA doesn't stand much of a chance.

I don't know how Hoot Mon will answer, but here is one that explains the problem. Specifically it is specification. And specification is never accidental to my knowledge. Not with this level of complexity... (source/ Phillip Johnson / Q&A section of the DVD Documentary, 'Unlocking the Mystery of Life')And if there is a disagreement with this argument, please engage the argument given and dispense with demeaning the character of the authority in question.Edited by Rob, : No reason given.Edited by Rob, : No reason given.

Kuresu:Alright Kuresu... I see the point. I still think it is a stretch when put into context with tall of the problems, but I'll give it to you (at least for now) as a single strand of the problems presenting the naturalist on this issue.How many other steps are there? And how many of them have been duplicated artificially or not?The point Hoot Mon is addressing (though his terminology may be in question by Adequate Word Doctors ) is that an RNA or DNA strand is specified to match a specific organism. And that is why I am reluctant to give credance to what I just agreed to.I will, but one strand of the problem is useless as I see it. The bigger problem is that a whole bunch of problems just as difficult all have to occur in the same submicroscopic space and in the right sequence.A solitary RNA strand serves no purpose other than to be incorporated with other cell structures into a living whole.It is more than baffling to me...

where to start, where to start . . . that's just plain wrong. you'll see my examples later in this post. meaning and information are two different concepts. wrong. you and I have different DNA. we both function. This is tantamount to saying that MAC OSX will not work because it is a variation of Windows Vista. Both work (well, once MAC OSX is released) he's never looked at DNA, apparently. This is the basic structure of DNA. (and yes, it's a cruddy schematic).phosphate--nitrogenous base (either A,C,T,G) --deoxy(ribose).Your DNA strand is but a bunch of these simple units put together, stack on top of eath other (so the [deoxy]ribose attaches to the phosphate of the second group).That's all DNA/RNA is. a repeat of that structure. how is this not a simple, repetitive structure?And what does being non-repeating have to do with information?
does:
AAACCCTTTGGG
or
ACTGTGACATGC
have information? what does this have to do with what has more information? or what information is?WORD . . .CATS. which one has more information?Does:
AAATTTCCCGGGAAATTTCCGGGAAATTTCCGGAATTCAGT
or
AAAAATTTTTCGCGCGTATATACGTACGTAATCGACGAAAT
have more information?and just how the heck does your post answer the question of
"why do genes need a purpose to exist?"?
Here's a hint. It doesn't. It totally evades and avoids the question, and brings up a different subject.mind actually answering the question?

---

"Have the Courage to Know!" --Immanuel Kant" One useless man is a disgrace. Two are called a law firm. Three or more are called a congress" --paraphrased, John AdamsWant to help give back to the world community? Did you know that your computer can help? Join the newest TeamEvC Climate Modelling to help improve climate predictions for a better tomorrow.

And we are different as a result. What Johnson was saying is that Rob can't have Kuresu DNA.The points stands though we are actually are very simmilar DNA-wise. But our differences make us truely unique.Do Macs use Microsoft software? I think that was the point. It is specified.Kuresu:The same way the 1's and 0's in the operating system of your computer are not repetative. They are incredibly complex.I guess to you, language is not complex because it is simply letters repeating themselves?They have no meaning or complex structure that is specified to a specific concept with which I can communicate through a physical media?What is the matter with you today? I've had a rather strong drink to settle down and I can still plough through this without much effort.Perhaps I overestimated both your intelligence and honesty.Kuresu:Accidents don't need a purpose. Specification is the result of intelligence matching a givenpattern. It is no accident unless you believe something cn come from nothing.So I guess that genes don't necessarily have to have a purpose. It is just that they do. They produce unique individuals
that are irreplaceable by any other.

actually, MACS can use microsoft word.Johnson's point was that if you have variation, the variation cannot work. OSX and Vista are two different arrangements of code. Both work. You and I have two different arrangements of code, we both work. Better yet, a banana tree and humans have different arrangements of code (even different numbers of chromosomes). both work, both function.
and what about computers that use multiple operating systems (like crashfrog's--i think he uses 3 or four different OS's on the same comp--all make the comp work)? really? is:
100101010101000101011011111100000000101010101111101010101000000 000010101010100000000010101010101000000000010101010111111111110101 010101000
complex? bull. it's only 1's and 0's.
12345322343457842956456475912757496593201945674921096567401956745 647120956457942091265745649576091726547564792987651947
is more complex. it has more parts. (the numbers 0-9), whereas the previous statement only had 1 and 0.which do you think is more complex?and just what does all this have to with with abiogenesis not being possible? never mind the fact that you have not really answered any of my questions in the post you responded to.since you've made several jabs at me, I'll make two toward you: you never put much effort into thinking, period. the strong drink only makes your abyssmal understanding even worse.Edited by AdminAsgara, : fixed long text string to change page width....

Yeah, sorry for the jabs... I was just confessing that tendancy to Phat earlier today. We all get so frustrated with each other. Are we competing and arguing more than seeking answers?I think sometimes... yes! At least I have such weakness...Kuresu:I wonder why we need strangely intelligent software engineers to write that simple repetative pattern you speak of?Don't get me wrong, forgetting your dismissal of the complexity (which is abject denial of the obvious) your point is valid!1-9 provides many more possibilities for complex arrangement than 1's and 0's.So... if a binary system (1 and 0) is complex (whether you admit it or not), then how much more complex is a biological system with four chemical digits (A C T G)?I have made this point to you before. You obviously disregarded what I was saying. We all have to stop and listen sometimes Kuresu. This may come as a shock... but even includes you and me.Edited by AdminAsgara, : fixed long text string to change page widthEdited by AdminAsgara, : No reason given.

and this has what to do with abiogenesis? near as I can tell, nothing.until you can answer that question, this whole tirade is off-topic.

Kuresu:Because Hoot Mon mentioned something pivotal as to the problem with understanding abiogenesis within a naturalistic framework. That of explaning the nature of information contained in DNA.And you asked why information needs a purpose to exist...And the simple answer is... because information is itself only exists for the purpose of communication.Consider Websters 2004 definition #3 for information: Quoted exactly as appears in the 2004 Merriam-Webster's colligiate Dictionary Eleventh EditionI would love to drive the point home, but big brother is always watching so I'll only hint...When it comes to DNA, think Close Encounters of the first kind... Edited by Rob, : No reason given.

you'll have to elucidate just why this is a problem for how abiogenesis happened.your answer: is bull. why? because you've changed your definition. first, you quoted johnson as to what information was. now you've got a different defintion, different idea. which are you going to use?and note--that definition does not give a purpose to information. only what information is.I'll repeat again, what does this have to do with abiogenesis? It's not a problem for abiogenesis.

Will you relax please... and think with me. You act as though you have an interest in the truth coming out a certain way.Kuresu:First of all, it doesn't mean it is not possible. It only means it is less probable without intelligent guidance. The more complex the arrangement, the less likely time and chance can explain it.That is why lotteries are hard to win. If they were based on only two numbers, it would be very probable that you would win. And the addition of factors adds improbability that is increased exponentially.Kuresu: I didnt change the definition. In one area we are talking definition. In the other we are talking about purpose.What it is is not the same as what for.A bicycle is one thing. It's purpose is another.Kuresu:Exactly...But just as a bicycle is one thing. It is inseperable from it's purpose. The definition doesn't manifest the purpose. The purpose is simply part of the definition. It wouldn't exist apart from the purpose for creating it, and that is the same for information and addresses the heart of you question to Hoot Mon.
The fact is, information does communicate something to us. It communicates the existence of an author. Books, computer software, scientific theories, etc... prove the existence of the author.The more complex, the less attributable to chance. And nothing that we have evidence for in this universe is as complex and sophisticated as life.What does that communicate to you? We think of life as natural, but it is the most unnatural thing there is. More so than any artificial attenpt by us to duplicate anything even remotely akin to an android. It is purely beyond us. It transcends our most confident proclamations of knowledge. In light of modern biology, life is only now just beginning to be seen for what it is.It is utterly alien. We are, that is.That is why it is relavant to abiogenesis...What abiogenesis?Why do you think very intelligent scientists talk about intelligent design? Why do others talk about Panspermia?Edited by Rob, : No reason given.Edited by Rob, : No reason given.Edited by Rob, : No reason given.

Well, he's just saying stuff. And it's a whole lot of crazy.If he could be bothered to provide supporting evidence for what he says, then I'd spend some time either showing that he's wrong or admitting that he's right.But instead he just says a lot of stuff. As though saying it magically makes it true.

This is, of course, not true. It tells me that life must be a consequence of the laws of nature, not as a consequence of whatever it is that you want "chance" to mean. "Talk about" is a far cry from "support", isn't it?

Right, let's look at this definition of specified information.

quote:

---

Information at the simplest level is just meaningful text.

---

Look, we're using logical fallacies already. No, that won't do for a definition, because it 'begs the question'. It implies a meaning, and then we conclude that the information has a meaning so must be designed. But information does not have to mean anything. This is the popular definition of information, but it is very imprecise. Instead, one should use a precise definition, such as that of Shannon.A better way to describe information is as a description of a state. So, GGGGGGGGG is a state, and '9 x G' is a description of that state. So, the information content of that state is quite low, due to the repeating nature of it. How about "GHYTIRKIM"? That state is itself the most reduced description, and so is essentially pure information. However, it contains no more information than the word "THEORISED", even though one means something to us (because of something we have assigned it, not because it contains more information).

quote:

---

And the order is specified, that’s point number two; which is to say that only one complex arrangement will do to operate the computer. If you got another one, you’ve got something that won’t work at all.

---

This is also false, depending on your definition of 'work'.If by work you mean...say, the computer can browse an internet page encoded in HTML.In that case, lots of codes will work. Some better than others, but Safari, Seamonkey, Firefox, Netscape, Opera and Internet Explorer can all read the same code.This is because many parts of the code are simply junk. The coders don't have the best, most precise code - there certainly is repetition and junk in it. Often, you will find that key parts of it are the same, but in different spots.An example in literature would be if an author wrote "It was a dark and stormy night" and another one wrote "That evening, there was a storm and it was difficult to see on account of the lack of light". Both have the same meaning, and serve the same purpose, but are in a different order. They have the same information too, but it shows that more than one code can do the same thing.The reason is, the meaning we want to convey is contained in only a few parts of that code, and the rest just serve as grammar to hold it up. The meaning of 'Dark', 'Stormy' and 'night' can be conveyed by different sets of information in different orders.

quote:

---

So it’s specified complexity. And a third feature is called aperiodic, or non-repeating. And that means it’s not the result of physical or chemical laws, because those laws always produce simple repetitive patterns.

---

Well, if you look at those two sentences above, you will find they are in fact the result of the laws of grammar in English. There are only certain ways that phrases can be arranged to mean something, else it will violate a law of grammar. For example:"Dark a stormy, and was, it night and that"I have adjectives with no noun associated with them, a clause without a noun and another one without a verb, and a conjunction without a cause. If this sentence was a molecule, it wouldn't hold up!

quote:

---

For example, you can imagine a book that’s written this way: you put a macro on your computer processor that says reapeat the letters ABC until the printer runs out of paper. And you’d get a book like that, and it wouldn’t be a very interesting book. And it would never get more interesting because the same laws that give you that pattern, ensure that you’ll never get a different pattern, or a more meaningful one.

---

Consider the following example:"Imagine a scribe working over a piece of literature - randomly assembled from a dictionary. Of course, it will be very small, perhaps only a dozen words in length. But this piece is copied by the scribe over, and over, and over. During this copying process, the scribe sometimes makes mistakes - maybe accidentally deleting or adding a word from the dictionary, or changing the order of a sentence, or even accidentally copying a phrase or clause one too many times. And every copy is heard by a group of critics, who ask for more copies of the pleasing works, and less of the unpleasant ones. The scribe does not add specific information to the book, having no knowledge of literature or grammar, but only random mistakes are added - still information, just not specified. The critics, on the other hand, know what good books sound like. Thus, during this process, the tastes of the critics are transferred to the book without them even editing it themselves."As you can see, it is possible to create a meaningful pattern if the laws mark it unfavourable to be a non-meaningful pattern.Evolution is the same: the environment and physical laws render it unfavourable for many forms of self-replication. Slow replicators are unfavourable, imprecise ones are unfavourable and non-replicators cannot be favoured at all. With this framework, and the laws of chemistry and physics, very effecient replicators can be formed via selection.The information for evolution is in the laws of the universe - it is not a biologists job to explain why that information is there, only how it gets incorporated into the cell.

quote:

---

And without exception, in all of our experience, you never get anything like that unless you have an author. To get computer software, you have to have a software engineer. To have an encyclopedia you actually need a lot of different authors and editors. To get the plays of Shakespeare, you need Shakespeare.

---

Now this is a combination of two fallacies - begging the question and affirming the consequent.Firstly, of course you need Shakespeare to get the works of Shakespeare - if someone else wrote it, it wouldn't be the work of shakespeare. Of course you need a software engineer to create software, they wouldn't be a software engineer if they didn't create software.Secondly, affirming the consequent:1. If A, then B.
2. B
3. Thus, A.For example:1. If there's smoke, there's fire.
2. Fire.
3. Thus, smoke.But fires are possible without smoke.1. If there's at least one intelligent agent, there will be a information created.
2. There is information created.
3. So, there is at lease one intelligent agent.But, perhaps it is also possible to create information without an agent? We can't rule it out, especially because we can see information without an obvious agent.

---

Help inform the masses - contribute to the EvoWiki today! Contributors needed in the following fields: Physical Anthropology, Invertebrate Biology (esp. Lepidopterology), Biochemistry, Population Genetics, Scientific Illustration, Scientific History, Philosophy of Science, Logic and others. Researchers also wanted to source creationist literature references. Register here!