|
Register | Sign In |
|
QuickSearch
EvC Forum active members: 65 (9164 total) |
| |
ChatGPT | |
Total: 916,913 Year: 4,170/9,624 Month: 1,041/974 Week: 368/286 Day: 11/13 Hour: 1/1 |
Thread ▼ Details |
Member (Idle past 1435 days) Posts: 20714 From: the other end of the sidewalk Joined: |
Thread Info
|
|
|
Author | Topic: MACROevolution vs MICROevolution - what is it? | |||||||||||||||||||||||||||||||||||||||
Taq Member Posts: 10085 Joined: Member Rating: 5.6
|
Faith writes: Since the fossil record is not a record of change from time period to time period as is claimed by OE and ToE theory, but a record of what lived before the Flood, you have no point. Then how did you determine that species never change?
I'd expect small changes in any population even over a few hundred years, so I'm talking about relative stability of a population in which the changes are hardly noticeable in any case. We are talking about evolution, which occurs over millions of years.
I'd suggest the wildebeests as a stable unchanging population, grizzly bears, polar bears, panda bears, any local population of raccoons, bobcats, lions, etc etc etc. Then show us how not a single mutation has changed one individual in those species. Until you do so, you are just blowing steam.
You get change when you get selection; otherwise you get stability even with all your mutations. Even the cheetah is stable, how long has it persisted? We already demonstrated that mutations cause change. You are just wrong.
|
|||||||||||||||||||||||||||||||||||||||
Taq Member Posts: 10085 Joined: Member Rating: 5.6
|
Faith writes: I've been consistently answering all the bogus "problems" you all keep bringing up. You have been answering the questions with made up fantasies which we have demonstrated are made up fantasies.
|
|||||||||||||||||||||||||||||||||||||||
JonF Member (Idle past 198 days) Posts: 6174 Joined:
|
Logic yes. Logic based on false premises is false.
Do you have any calculations or observations of the real world whether there are enough beneficial mutations (or neutral but beneficial when the environment changes, or detrimental but conferring some benefit before it's lost) to account for no inevitable loss of diversity? Of course you don't. You made it up, you believe it, and you think that everything you believe should be regarded by all as established fact. Doesn't work that way.
|
|||||||||||||||||||||||||||||||||||||||
Faith  Suspended Member (Idle past 1474 days) Posts: 35298 From: Nevada, USA Joined: |
This is absurd. The understanding that mutations are predominantly neutral, many deleterious and a very very few beneficial is so commonly known I wouldn't expect to have to justify it. There must even be many threads at EvC that affirm this. Where are the honest evos who know this is the truth and will say so?
|
|||||||||||||||||||||||||||||||||||||||
CRR Member (Idle past 2272 days) Posts: 579 From: Australia Joined: |
Let's have a look at a simple hypothetical example. We will start with Species OG (for original gangster).
Species OG allele A TTTTTTTTTTTTTTTTTTTTSpeciation begins by the creation of two isolated populations of the OG population so that we have Sub Species OGa and Sub Species OGb Subspecies OGa allele A Subspecies OGb allele A TTTTTTTTTTTTTTTTTTTT TTTTTTTTTTTTTTTTTTTTMutation and selection occurs in each population, but since different mutations and selection pressures occur in each subspecies they end up with different alleles: Subspecies OGa allele B Subspecies OGb allele C TTTTTTTTTTTTTTTTATTT TTTTTTGTTTTTTTTTTTTTThose separate subspecies have now diverged, all through microevolution. This same process occurs again. Subspecies OGa allele D Subspecies OGb allele E TTCTTTTTTTTTTTTTATTT TTTTTTGTTTTTTTGTTTTTAnd it occurs again: Subspecies OGa allele F Subspecies OGb allele G TTCTTTTTGTTTTTTTATTT TATTTTGTTTTTTTGTTTTTAnd it occurs again: Subspecies OGa allele H Subspecies OGb allele I TTCTTATTGTTTTTTTATTT TATTTTGTTTTCTTGTTCTTLet's freeze time and compare these new subspecies with the OG species Subspecies OGa allele H Subspecies OGb allele I TTCTTATTGTTTTTTTATTT TATTTTGTTTTCTTGTTCTT Species OG allele A Species OG allele A TTTTTTTTTTTTTTTTTTTT TTTTTTTTTTTTTTTTTTTTNow when the isolated populations merge we have two different alleles. Note that no new genes have been created, just two corrupted versions of the original. Hence this can be regarded as microevolution. In most cases this won't prevent interbreeding; like blue eyed and brown eyed people can still have children. If however this and other changes hampers interbreeding you might get two separate species within the same kind; such as horses and donkeys. We have speciation by microevolution.This may well have been one of the mechanism by which the relatively few kinds on Noah's Ark developed into the much greater number of species we see today. Edited by CRR, : Amended last sentence.
|
|||||||||||||||||||||||||||||||||||||||
CRR Member (Idle past 2272 days) Posts: 579 From: Australia Joined: |
Faith writes:
That is so, and very few of the beneficial mutations are due to increases in genetic information. The understanding that mutations are predominantly neutral, many deleterious and a very very few beneficial is so commonly known I wouldn't expect to have to justify it. In fact many of what were regarded as neutral, where the same amino acid is coded for, may turn out to be detrimental. Sometimes the alternative coding is a Duon which will change the regulation of the gene; and sometimes it results in a transcription pause or the loss of one, which can hamper proper folding of the protein.
|
|||||||||||||||||||||||||||||||||||||||
PaulK Member Posts: 17828 Joined: Member Rating: 2.5 |
quote: And you haven't been asked to justify that. Now how about actually answering Jon's question ?
Do you have any calculations or observations of the real world whether there are enough beneficial mutations (or neutral but beneficial when the environment changes, or detrimental but conferring some benefit before it's lost) to account for no inevitable loss of diversity?
|
|||||||||||||||||||||||||||||||||||||||
Faith  Suspended Member (Idle past 1474 days) Posts: 35298 From: Nevada, USA Joined: |
(JonF) Do you have any calculations or observations of the real world whether there are enough beneficial mutations (or neutral but beneficial when the environment changes, or detrimental but conferring some benefit before it's lost) to account for no inevitable loss of diversity? Even if ALL mutations were beneficial, selection inevitably brings about loss of genetic diversity. Edited by Faith, : No reason given.
|
|||||||||||||||||||||||||||||||||||||||
PaulK Member Posts: 17828 Joined: Member Rating: 2.5 |
quote: That is neither a calculation nor an observation. If you mean that there is an inevitable overall decline you need to back it up - and if you don't then you are just wasting time.
|
|||||||||||||||||||||||||||||||||||||||
Faith  Suspended Member (Idle past 1474 days) Posts: 35298 From: Nevada, USA Joined: |
It's been backed up over and over and over again. There's no way it can't happen, and besides it's even been agreed that it happens. Breeding examples are the clearest demonstration of why and how it has to happen even in nature. Selection has to reduce genetic diversity, that's all there is to it. You can't get a population of new phenotypes if genetic material for other phenotypes remains at any appreciable level in the population. There is no need for calculations, the logic is clear.
Edited by Faith, : No reason given. Edited by Faith, : No reason given.
|
|||||||||||||||||||||||||||||||||||||||
PaulK Member Posts: 17828 Joined: Member Rating: 2.5
|
quote: If you count claims that a car will inevitably run out of fuel even if you keep the tank topped up. Seriously, no. It has never been supported with any serious argument.
quote: You've been told how it could fail to happen. And it has not been agreed that it will inevitably happen.
quote: It's funny how all your examples are entirely compatible with the opposing view.
quote: And mutation will replace that diversity. Unless you can show that it has too small an effect - which would require calculations or observations.
quote: The logic is clearly inadequate.
|
|||||||||||||||||||||||||||||||||||||||
Faith  Suspended Member (Idle past 1474 days) Posts: 35298 From: Nevada, USA Joined: |
The gas analogy doesn't work.
|
|||||||||||||||||||||||||||||||||||||||
dwise1 Member Posts: 5952 Joined: Member Rating: 5.7
|
The logic of the argument has been clear all along. Logic! Oh how that poor word has been misused for all these years! But thanks to CDR Spock, when I started college in 1969 one of the first classes I attended was in logic. Formal logic. The primary problem with logic is that it is completely dependent on structure, not on truth. Is your argument valid? That is all that logic can determine. Whether your argument is valid. If your argument is valid, then if you plug true premises into it, you should get true conclusions. If your argument is not valid, then you have not idea what you are getting. So then, Faith, your problem here is two-pronged: 1) is your logic valid?, and 2) are your premises valid? At the very least, your premises are highly suspect.
|
|||||||||||||||||||||||||||||||||||||||
dwise1 Member Posts: 5952 Joined: Member Rating: 5.7
|
Seriously?
There's a common second year algebra problem in which you have a water tank with an input that is pouring water in at a given rate and a drain which is draining off that water at a given rate and after a given amount of time you are to determine how much water is in that tank. You are asking us to ignore the water that is pouring into the tank. The gasoline analogy does indeed work. It just does not support your contrary-to-reality fantasy.
|
|||||||||||||||||||||||||||||||||||||||
dwise1 Member Posts: 5952 Joined: Member Rating: 5.7
|
No, Faith, what you choose to imagine within your own highly limited noggin will not suffice. I mean, you cannot even handle reading an actual study of simple probabilities, so how much can we trust your ability to completely overturn all of evolutionary science that all knowledgeable scientists have already worked out with great care, all worked out within your own noggin which has already been demonstrated to be too limited to handle any and all discussion of even the simplest of probability calculations.
The logic is far from clear. The need for actual calculations is paramount. Please provide those actual calculations.
|
|
|
Do Nothing Button
Copyright 2001-2023 by EvC Forum, All Rights Reserved
Version 4.2
Innovative software from Qwixotic © 2024