Why is evolution so controversial?

What do you mean "instead of"? Both of those figures are from the same paper, and they are measurements of different things. The 1.33% is a measurement of the number of changes in the DNA we still share with chimps. The 5% includes the divergence caused by DNA we no longer share, the DNA that has either been removed or added to each lineage. These are answers to different questions, not an "instead of". Based on what evidence? The 1.33% involves 35 milllion mutation events. The 5% involves the addition of just 5 million more mutation events. Why do you think the addition of just 5 million more mutations pushes it over the edge? Yes, just as most atmospheric molecules are either nitrogen or radon. Neutral mutations are not added to those genetic loading numbers. You would have to show that the U would be too high, first.

The 5% is not the number of mutations but the number of bases that are different. An indel may cover thousands of bases, but it is only counted as one mutation. That is what you are getting wrong.

Then why do you use 5% in your calculations? If you use 5% then you are saying that all 5% were substitutions.The real number is 35 million substitutions and 5 million indels between both lineages, or 20 million total mutations per lineage. That is the real number. If you are using 5% of 3 billion, or 150 million mutations, then you are way off."Here we present a draft genome sequence of the common chimpanzee (Pan troglodytes). Through comparison with the human genome, we have generated a largely complete catalogue of the genetic differences that have accumulated since the human and chimpanzee species diverged from our common ancestor, constituting approximately thirty-five million single-nucleotide changes, five million insertion/deletion events, and various chromosomal rearrangements."
Initial sequence of the chimpanzee genome and comparison with the human genome | NatureEdited by Taq, : No reason given.

The standard methods use parsimony as the guiding principle which means that the difference is the fewest mutations needed to to reconstruct the ancestral genome, if my understanding is accurate. The algorithms used for alignment may not be completely standardized, but I have yet to see massive differences between alignment methods that would allow for 5 or 10 fold differences in mutation rates.In other words, a 4 base gap in an alignment is assumed to be a single indel event of 4 bases in stead of 4 individual indel events. Zaius is treating a 4 base indel as 4 separate mutations. A point mutation is assumed to be a single change in one lineage instead of multiple mutations at the same base. Sequence that can not be aligned with strong confidence is kept out of the comparison.Edited by Taq, : No reason given.Edited by Taq, : No reason given.

If you are going to use indels, then you need to treat them as single mutations. 1.33% divergence is correct because 1.33% of 3E[9] is 39.9 million mutations, the total number of substitutions and indels added together.Also, you only have an effective population size of 1,000. That's way low. Most calculations use a minimum of 10,000, and many have 100,000.edit: mistakenly had 3E6 for human genome size before.Edited by Taq, : No reason given.Edited by Taq, : No reason given.

For the number of mutations you use a haploid genome. You will notice in the chimp genome paper that they list the coverage as more than 90%, and the total number of bases sequenced as 2.7 billion bases."The ARACHNE assembly has slightly greater continuity (Table 1) and was used for analysis in this paper. The draft genome assemblygenerated from ~3.6-fold sequence redundancy of the autosomes and ~1.8-fold redundancy of both sex chromosomescovers ~94% of the chimpanzee genome with >98% of the sequence in high-quality bases."
Initial sequence of the chimpanzee genome and comparison with the human genome | NatureHere is a table showing the total number of bases sequenced:Initial sequence of the chimpanzee genome and comparison with the human genome | NatureThe 40 million total mutations are referring to a 3 billion base haploid genome.

Do you really think that the human population always grew at a set rate? Really? That's a completely unsupported assumption.

Just to make this clearer, here are two made up sequences

AAGTGTTACCGAGTCCATAAATGCCCC
AAGTGTTA_____TCCATAAATGCCCC

There are 27 bases in the top sequence. When we do an alignment with the bottom sequence we see a 5 base gap. This is a 5 base indel. Using parsimony, this would be considered a single 5 base indel event, a single mutation.However, the sequences only match at 20 of 27 bases. Therefore, they have~ 80% sequence identity at the base level. One mutation produces a 20% difference.This is why you can't use the difference in bases as a measurement of the number of mutations.Edited by Taq, : No reason given.Edited by Taq, : No reason given.

This is a good point, and worth stressing. Any result is tied to the methodology. In order to compare apples to apples, the methods need to be comparable. Unfortunately, creationists like the drastically change the methods of comparison in order to cast doubt on the results from other methods, as in this example.Zauis is also switching methods while pretending the numbers are comparable. The 5% that he is citing is the number of bases that differ between the two genomes. He then pretends that this is the same as the number of mutations.So while we can all agree that the choice of algorithms, methods, and definitions is somewhat arbitrary, this doesn't mean that you can arbitrarily compare results.

The yield per acre and the people needed per acre has changed drastically through time, and it even differs between modern societies.You have made an unwarranted assumption that the human population has grown at the same rate throughout history.

Why should any PhD be shaken by claims that are founded on false assumptions? There is absolutely no reason why any population should grow at the same rate throughout history.

I see no reason why Darwin, if he were alive today and was aware of all the current research, would disagree with the mechanisms of epigenetics that science has discovered. He would explain them just as you have, as the consequence of DNA methylation and histone ubiquitination. It would be vulnerable to genetic drift just like the other 80% or so of the genome that does not have selectable function.

In this thread, all you have shown is that you don't fully understand the science. For example, you failed to understand that a 1,000 base indel is counted as a single mutation, not as 1,000 individual mutations. You also assume that populations always increase in number at a set rate. There is absolutely no science to back this up.In other words, I would suggest some introductory jousting lessons before you go tilting at windmills, Don Quixote.

Why did you pick 5% divergence for estimating the number of mutations needed for humans and chimps to evolve from a common ancestor?

That number is the number of bases that differ between. That is not the indel count. A single indel can cause two genomes to vary by more than 1 base. That is what you keep getting wrong. Here is yet another example using two random sequences.

Seq A: ggcaataa_____tgctcgt
Seq B: ggcaataaccggatgctcgt

Those sequences differ by 25% at the level of the DNA bases. They differ by 1 indel, by one mutation. If you use the base difference, your estimate of the number of indels would be 25 times too high.As sfs states, the good estimate for the indel rate is 1/7th of the substitution rate. Therefore, the number of mutations is (1.23)+(1.23/7)=1.4%. Not 5%.Edited by Taq, : No reason given.