|
Register | Sign In |
|
QuickSearch
Thread ▼ Details |
|
|
Author | Topic: The End of Evolution By Means of Natural Selection | |||||||||||||||||||||||||||||||||||||||||||
Faith  Suspended Member (Idle past 1475 days) Posts: 35298 From: Nevada, USA Joined: |
Mutations are random. I'm not aware of any evolutionist here who is so ignorant he thinks mutations are not random. I'm not aware of any evolutionist here who is so ignorant that he would suggest that the necessary mutations are supplied when needed. Sure sounded like that, so of course I was interested in finding out if he could have meant such a thing.
If you think any evolutionist here is suggesting that mutations aren't random or that they're supplied when needed then you can safely assume you are misunderstanding him. OK.
The random mutations that occur in every generation are operated on by selection. Any mutations that provide some advantage in the existing environment will become increasingly prevalent in subsequent generations. It isn't that *the* necessary mutation is provided when needed. What Dr. A said sure sounded exactly like that.
There is no known process in evolution that could do such a thing. What I would have thought, but then what he said sounded like something else.
Rather, it's that every member of each new generation gets a number of random mutations simply because DNA copying during reproduction is imperfect, and inevitably some of them are helpful in the current environment. Theoretically, assumed to be, not known to be ---except of course in bacteria.
About your allele question, an allele is a sequence of codons that program for a protein. An allele that experiences a point mutation (substitution of one nucleotide for another) is likely a new allele. For example, say a gene in a population has these four alleles, they differ from one another by a single nucleotide: CATGCCTTACGTCATGCTTTACGTCAAGCTTTACGTCATGCCTTCCGTLet's consider one of the organisms in our population that happens to contribute the 1st allele in the list to it's offspring during reproduction, but there's a copying error and one of the nucleotides is copied incorrectly. For example, maybe CATGCCTTACGT becomes CATGCCTTACGA. It is possible that the copying error could transform it into one of the other three alleles, but it is more likely that it would become a brand new allele. If it is a new allele then some of the possible resulting effects are: Nothing, because the new codon codes for the same amino acid as the original. Nothing, because although the new codon codes for a different amino acid, the slightly different protein with the different amino acid performs the exact same function as the original protein. A change in protein function that is deleterious because the altered protein is broken and does nothing, leaving the organism without a possibly important protein. A change in protein function that is beneficial because the altered protein does a better job then the original protein "THAN the original protein." In the last year or so for some reason people have been writing "then" for "than." How on earth did this mistake get started? The internet is a pernicious influence, it just spreads such errors. Anyway. All sounds exactly as expected, including the unproven evolutionist assumption that it could ever have a beneficial result. Edited by Faith, : No reason given. Edited by Faith, : No reason given. Edited by Faith, : No reason given.
|
|||||||||||||||||||||||||||||||||||||||||||
Faith  Suspended Member (Idle past 1475 days) Posts: 35298 From: Nevada, USA Joined: |
My subject is what happens when you have isolation of a smaller population and natural or random selection, because that's where the new varieties come about, and ultimately speciation as well. You mention speciation as a possibility again, but in the very recent past you denied that speciation was a possibility, saying that you only used the term as a concession to evolutionists and that speciation wasn't really what evolutionists think it is. Answered this above in Message 671 In my Message 640 I explained why I think speciation is impossible in your scenario, but you didn't respond. It would be very helpful if we could get an answer about whether you think your scenario can produce genetically distinct species, meaning species that are genetically incompatible. Yes, also explained above, in Message 679.
Faith writes: Taq writes: Faith writes:And could I ask what's wrong with the "old alleles" in everybody's mind anyway? Why are you so eager to get rid of them? I am not "eager" to get rid of them. What I am is eager to explain reality, and in reality old alleles are replaced by new ones. Again, it's funny how you assert such a thing as if it were fact with such a lack of evidence, only evidence for mutations making disease or making changes that don't do anything helpful. Except in bacteria of course. I guess. When you speak of the lack of evidence for beneficial mutations you should really be saying that you're going to continue to ignore the evidence for beneficial mutations. I see a lack of evidence a very glaring lack of evidence, just arguments from theory and arguments from bacteria and otherwise the ACTUAL evidence is all of nothing happening or diseases happening.
In another of my messages that you didn't reply to, Message 421, I explain why beneficial mutations are inevitable. Briefly, it points out that unless all genes already have optimal alleles, random change will inevitably create new alleles that are more optimal than existing ones. Seems to me that probability is so enormously against anything at all that functions "optimally" being randomly produced by a mistake in the replication of thousands of nucleotides, that to say it's "inevitable" shows a really extreme level of unwarranted optimism.
A more fundamental argument for beneficial mutations is that every allele in every gene in all life everywhere throughout time began as a mutation. The genes of all existing life consist of billions and billions of mutations that proved beneficial. Amazing how you'll recite this mantra, which is nothing but an assumption made necessary by evolutionary theory without a shred of empirical evidence for it, and expect it to be treated as if it were an actual empirical fact. Truly amazing.
I don't say "can only be" I say that the evidence you actually have shows this. Evidence. Evidence. The only evidence otherwise that you can ever point to is bacteria. There's something wrong with this picture. Well I can see how from your perspective there's something very wrong with this picture of the real world, because it doesn't support anything you say. You even think your mere assumption is the "real world" and my objecting that there's no real empirical evidence is the mistake. Truly Wonderland stuff here Percy.
Why don't we break the picture down for you and you can tell us what is wrong with it. Because of the complex interplay of many systems in complex organisms, beneficial mutations must of necessity occur in tiny indetectable steps. Beneficial mutations that are easily detectable are necessarily rare. Do you have a problem with this? Except that it's an exercise in pure Reason?
Because of relatively long generation times, studying the effects of sequences of mutations over a meaningfully large enough number of generations in complex organisms isn't really possible. Do you have a problem with this? Yeah, I really do think if they were real you wouldn't have to depend on such excuses. But of course if you would treat it all as hypothetical instead of insisting on it as Fact there wouldn't be so much objection.
Considering only point mutations (single nucleotide substitutions), mutations in bacteria do the same thing as in all other organisms, potentially changing what the protein produced by the gene does. Do you have a problem with this? No, I assume a change in the DNA will change what the protein produced does.
Unless you have problems with some of these basic concepts, then simple logic leads to the conclusion that just as a mutation in a bacteria can end up producing a protein that is better than the proteins produced by the existing alleles, so can a mutation in any other organism end up producing a protein that is better than the proteins produced by their existing alleles. Except that probability is enormously against it and you haven't one shred of evidence for it. Logic is not enough here. Way too much opportunity for intellectual fraud.
While the generation times in complex organisms are too long to observe the complete process in an experiment of any reasonable length, the general principles are the same as in bacteria, and what we see in genomes and what parts of the process we are able to observe in complex organisms is precisely what we would expect to see if mutations are the source of variation. Uh huh, well, I guess you've got yourselves convinced. But please don't try it on me.
What we never see: polyploid chromosomes in large populations hiding extra variation that isn't expressed. Good thing I never suggested such a thing then. Edited by Faith, : No reason given. Edited by Faith, : No reason given.
|
|||||||||||||||||||||||||||||||||||||||||||
Faith  Suspended Member (Idle past 1475 days) Posts: 35298 From: Nevada, USA Joined: |
OK, I'll concede this point. In other words the chemical coding system can produce disease, deleterious effects, no apparent effect, or something viable, just in the nature of random chemical changes. OK. Then the only question is whether or to what extent this actually occurs in reality. You're asking the wrong question. It isn't a matter of whether it "occurs in reality." It's a matter of what could ever stop it from occurring. The Law of Probability.
Let's look at it from a slightly different angle. Can we agree that it is possible for none of the alleles of a gene to be optimal? In other words, can we agree that is possible that a tiny change (i.e., a point mutation, an error in a single nucleotide) to one of the alleles for a gene would transform it into an allele that is superior to any of the existing alleles? Possible, but highly improbable.
If we can agree on that, then what would prevent such a change from occurring? Nothing, right? Except the high improbability.
Now, taking the human race as an example, realize that each individual has one new allele on average, and that around 134 million babies are born each year. Each baby contributes one new allele to the world population. Current estimates give us around 20,000 protein-coding genes, so that's 134 million new alleles for 20,000 genes, or around 6700 new alleles per gene, on average. Every year. Year after year. Endlessly. Unless all genes contain optimal alleles, beneficial mutations are inevitable. The probability is that a mistake in gene duplication will produce an allele that is also a mistake, will code for nothing much or will code for something deleterious to the organism. And the actual evidence in hand bears this out. So the odds are that each of those new alleles we're all born with does something along those lines. The exception would be a beneficial allele because it would have to be exact. The others don't have to be exact. Any old mistake can produce disease or nothing much but a beneficial allele would be a real fluke. Not impossible but SO highly improbable the odds are way against it ever happening.
|
|||||||||||||||||||||||||||||||||||||||||||
Faith  Suspended Member (Idle past 1475 days) Posts: 35298 From: Nevada, USA Joined: |
And what sort of "improvement" do you think there is?
There really isn't any improvement with time. There are new varieties, interesting new varieties, but improvement? The fossil record supports nothing but the awesome array of living things that thrived in the pre-Flood world. Edited by Faith, : No reason given.
|
|||||||||||||||||||||||||||||||||||||||||||
Faith  Suspended Member (Idle past 1475 days) Posts: 35298 From: Nevada, USA Joined: |
And what sort of "improvement" do you think there is? There really isn't any improvement with time. There are new varieties, interesting new varieties, but improvement? False. Examine the fossil record, supported by genetics, from the Paleocene to the present and tell me the primates have not improved. (Paleocene, yes that's millions of years. Sorry, that's what the evidence shows.) They are just a motley collection of primates, all living together at the same time. It's a delusion that one succeeded another. The history of how the age of the earth was determined shows that evidence was no part of it. Ol' Hutton took a look at a pile of rocks on the coast of Scotland and said "gotta be old," and that's the origin of OE theory. Time estimates since then have simply vied to outdo the previous. Evidence, ha!
The fossil record supports nothing but the awesome array of living things that thrived in the pre-Flood world. False. The flood is a myth. Even the early creationist geologists, seeking to document the flood, gave up just about 200 years ago. Poor things were looking in all the wrong places and believed the delusions that started turning up in authoritative "scientific" circles.
Since then the evidence against the notion of a global flood some 4,350 years ago has become overwhelming. Oh nonsense. Everywhere you look you could see the evidence if you'd just open your eyes.
I have produced evidence disproving the flood in my own archaeological research. Want to hear about it? Not really. Certainly not on this thread. I'll go laugh at it if you want to put it up on its own thread though. Edited by Faith, : No reason given. Edited by Faith, : No reason given.
|
|||||||||||||||||||||||||||||||||||||||||||
Faith  Suspended Member (Idle past 1475 days) Posts: 35298 From: Nevada, USA Joined: |
A human being has to result from the chromosome combo so why not me, but a mistake in replication doesn't have to produce anything but a mistake.
Edited by Faith, : No reason given.
|
|||||||||||||||||||||||||||||||||||||||||||
Faith  Suspended Member (Idle past 1475 days) Posts: 35298 From: Nevada, USA Joined: |
I understood you just fine. You misunderstood me. Your comparison doesn't work.
|
|||||||||||||||||||||||||||||||||||||||||||
Faith  Suspended Member (Idle past 1475 days) Posts: 35298 From: Nevada, USA Joined: |
In fact many YECs DO accept that speciation occurs and if they use their own definition of macroevolution it still doesn't change the fact that the scientific definition of macroevolution includes speciation by definition. The lack of intellectual honesty in this is on the evolutionist's side, simply definitionally making a new frog variety into a new species by terminological sleight of hand.
What I expect from anyone in a debate is intellectual honesty and a recognition that they do not get to dictate what is and is not true. I don't have to believe something just because you say it. Exactly my position. You don't get to dictate what is and is not true, and in the case of the term speciation it's just a definitional ploy.
Of course, if you were being intellectually honest there is no reason why you could not accept the scientific definitions. There is no good reason to secretly use private definitions at all - it can only mislead and deceive. And that's all there is here. That is a lie, just a self-serving lie.
According to the scientific definitions speciation happens and therefore macroevolution happens. And you admit that. I admit that the event called speciation happens. It is not macroevolution and it is nothing but lying word magic to call it macroevolution.
Just introducing your own definitions - which are not even adequately defined - does nothing to deny these facts. It just makes you look like someone who absolutely refuses to accept the truth. What I look like among lying delusional evolutionists can hardly matter.
And now you want to tell me that you really accept that speciation happens and macroevolution happens - by the scientific definitions of these words - but that you secretly switched to using private definitions you hadn't even shared with us ? That would be a very silly - and dishonest - thing to do. That is a self-serving lie.
So there is a real event that you all call speciation and I really don't have a problem with that term as such UNTIL you try to force me to accept the evolutionist interpretation of it, which is what you are doing now. But I'm not trying to force an interpretation of speciation on you. Speciation is by definition the formation of a new species, and the inability to interbreed in the wild is accepted as a valid criterion for speciation. That's it. It's accepted by self-serving delusional evolutionists and I have a right to disagree with you all.
There's no special interpretation here, just definitions and scientifically accepted criteria. When science is simply what evolutionists call it, science is a sham.
If you want to argue honestly the best thing you can do is accept the scientific definitions and criteria. Not refuse to accept them because you have an irrational objection to accepting that macroevolution occurs. Macroevolution does not occur and evolutionist insistence that what is really still the same species is a new species in the sense of macroevolution is a dishonest trick.
And my argument itself is intended to show that macroevolution is impossible, so to try to force that term on me is pretty underhanded. Of course I'm not doing anything underhanded. If you misunderstand the meaning of the word macroevolution and if in fact your argument does not show that macroevolution as scientifically defined is impossible that is your problem - I'm not doing anything "underhanded" in pointing it out. You never intended your argument to rule out speciation - as scientifically defined - nor even macroevolution - as scientifically defined. This point doesn't affect your arguments or your intent at all. You simply misunderstood what macroevolution is. I know what it implies and the use of the term is underhanded, tendentious and dishonest.
The only problem here is the one that you create for yourself. If you make a mistake - and it is your responsibility to try to avoid making mistakes - accept it and move on. Don't issue angry and incoherent denials or accuse others of dishonesty simply for pointing out a truth that you don't like. Are you really so ruled by pride and anger that you can't handle honest debate ? The dishonesty here is yours. Probably also the pride and anger. Edited by Faith, : No reason given.
|
|||||||||||||||||||||||||||||||||||||||||||
Faith  Suspended Member (Idle past 1475 days) Posts: 35298 From: Nevada, USA Joined: |
Gene replication that produces mutations is a mistake. Mistakes breed mistakes. That's what's probable. Getting something functional out of a mistake is what's improbable.
Edited by Faith, : No reason given.
|
|||||||||||||||||||||||||||||||||||||||||||
Faith  Suspended Member (Idle past 1475 days) Posts: 35298 From: Nevada, USA Joined: |
I will not discuss bacteria. If that's your only evidence, you are out of luck.
Edited by Faith, : No reason given.
|
|||||||||||||||||||||||||||||||||||||||||||
Faith  Suspended Member (Idle past 1475 days) Posts: 35298 From: Nevada, USA Joined: |
Mistakes breed mistakes. Surely mistakes in copying simply produce imperfect copies. I.e. change. No? It's illogical. To call an error a mere neutral "change" is some kind of deception.
Whether or not that change is beneficial or harmful will depend on what the change is and what environment it is operating in. No? Yeah, right, so goes the theory. The theory is a deception. Start with the fact that the actual empirical evidence you have is that mutations produce diseases or do nothing much at all (except in the ever-handy bacteria of course), and that the claim that nevertheless they produce something beneficial is only because the theory says they do, and you've got major deception going on.
That's what's probable. Getting something functional out of a mistake is what's improbable. Do you accept that it is possible? I think we can (in fact I think Percy has already) calculated a probability example. He has the definition of mistake = neutral change. With that definition you can do anything you want. Calculate a mistake as a mistake in the replication of billions of nucleotides and if you EVER get a beneficial result it would be a fluke. Sure, flukes are possible. Every few bazillion chances or something like that.
You seem wedded to the notion that any imperfection in copying must result in a harmful end result to the organism in question. But I am not sure why you think this must be the case. Because the actual evidence says so and the contrary idea is dictated purely by assumption based on theory.
|
|||||||||||||||||||||||||||||||||||||||||||
Faith  Suspended Member (Idle past 1475 days) Posts: 35298 From: Nevada, USA Joined: |
I would suggest HIV resistance and lactose tolerance as examples of beneficial changes that have occurred in the sort of timescales Faith might accept. 1) It's pathetic how LITTLE you can come up with as evidence for your claim. 2) Go ahead, prove that HIV resistance and lactose tolerance are CHANGES, are NEW, are MUTATIONS. Let's see it. If we didn't have lactose tolerance for the last six millennia how would we ever have depended as much as the human race has on milk products over all that time? If anything HIV is more likely to have been the result of removal of natural resistance by mutation. Lactose INtolerance too, same thing, come to think of it. But let's see your evidence, bring it on. Edited by Faith, : No reason given. Edited by Faith, : No reason given. Edited by Faith, : No reason given.
|
|||||||||||||||||||||||||||||||||||||||||||
Faith  Suspended Member (Idle past 1475 days) Posts: 35298 From: Nevada, USA Joined: |
"Errors are synonymous with badness."
Something so bizarre about the idea that an error can be a good thing. Just wacko. In any other context, such as if you get the wrong answer to a math problem, or don't believe in evolution !!!!!!!! -- your error is "bad" - it's never "good" it's never right. But somehow in genetics an error can be good. There is something wrong with a mind that can accept such an idea.
|
|
|
Do Nothing Button
Copyright 2001-2023 by EvC Forum, All Rights Reserved
Version 4.2
Innovative software from Qwixotic © 2024