|
Register | Sign In |
|
QuickSearch
Thread ▼ Details |
Thread Info
|
|
|
Author | Topic: Why is evolution so controversial? | |||||||||||||||||||||||||||||||||||||||
zaius137 Member (Idle past 3440 days) Posts: 407 Joined: |
New papers showing a drop in human chimp similarity abound. Regardless if the percentage number I used is right, the conclusion is still bad for evolution.
Here is representation of a SNP verses a indel event. Both are mutations and both decrease the sequence similarity (bp count is irrelevant).
Humans and chimps are far different than just 1.3% in their genomes. It seems like a perfect storm in new genetic discoveries all against common descent. Outlining the individual problems from genetic studies: There are not enough mutations available since divergence to accommodate a 95% similarity. 5.6 million years (the fossil nonsense) is below the needed time frame to produce enough beneficial mutations from divergence. Excessive junk DNA in the human and chimp genome is not real. Ancient bottlenecks in small human populations is unstable and can not explain observed linkage disequilibrium in humans. Epigenetic’s can not be explained by Darwinism. There is a mitochondrial Eve and a Y chromosome Adam.
|
|||||||||||||||||||||||||||||||||||||||
Coyote Member (Idle past 2137 days) Posts: 6117 Joined: |
Nonsense!
Just to select one: Are you even aware of what the so-called mitochondrial Eve really represents?Religious belief does not constitute scientific evidence, nor does it convey scientific knowledge. Belief gets in the way of learning--Robert A. Heinlein How can I possibly put a new idea into your heads, if I do not first remove your delusions?--Robert A. Heinlein It's not what we don't know that hurts, it's what we know that ain't so--Will Rogers If I am entitled to something, someone else is obliged to pay--Jerry Pournelle If a religion's teachings are true, then it should have nothing to fear from science...--dwise1 "Multiculturalism" does not include the American culture. That is what it is against.
|
|||||||||||||||||||||||||||||||||||||||
sfs Member (Idle past 2564 days) Posts: 464 From: Cambridge, MA USA Joined: |
quote:The human and chimpanzee genomes differ in single-base substitutions at a rate of 1.23%. The single-base mutation rate is currently estimated to be roughly 1.1 x 10^-8/bp/gen. Using your other values, that gives t = 7.2 million years. If you want to include indels, you have to increase the divergence by one-seventh. Unfortunately, we don't have a good independent estimate of the indel mutation rate, but a rate 1/7th that of substitutions is completely plausible.
|
|||||||||||||||||||||||||||||||||||||||
zaius137 Member (Idle past 3440 days) Posts: 407 Joined: |
quote: As I understand the paper at Estimate of the Mutation Rate per Nucleotide in Humans | Genetics | Oxford Academic, (k) is estimate under a neutral model for total divergence between chimps and humans (their number 1.33%). Mutation rate by empirical measurement was found to be ~70 new mutations per generation (that is a mutation rate of 1.1 x 10^-8 mutations in the diploid genome per generation) that would be (u). The calculation they preformed estimating mutation rate was based on effective ancestral population (Ne), specie divergence and time of divergence being 5.6 million years. This produced a calculated mutation rate of ~175 mutations per generation (u) or(2.5 x 10^-8) to time of divergence. This is about twice the measured mutation rate in humans. You claim mutation rate of indels to be 1/7 that of substitutions, that would be ~ 10 per generation. This would give a new mutation rate of (1.3 x 10^-8) per generation. This has nothing to do with the (k).
quote: That is fine, I accept 1/7 that of the empirical value for substitutions. The actual value calculated for the generations from divergence did not change that much. Sorry. Edited by zaius137, : No reason given. Edited by zaius137, : correction...
|
|||||||||||||||||||||||||||||||||||||||
zaius137 Member (Idle past 3440 days) Posts: 407 Joined: |
quote: Perfect time to present your understanding. I am familiar with the evo perspective but my personal view differs somewhat.
|
|||||||||||||||||||||||||||||||||||||||
sfs Member (Idle past 2564 days) Posts: 464 From: Cambridge, MA USA Joined: |
I don't know what point you're trying to make in your response. Using your (correct) formula from Nachman and Crowell, and the values you specified for ancestral population size, generation time and mutation rate, and using the best estimate for human/chimpanzee divergence, the estimated divergence time is 7.2 million years. If you use different numbers, you'll get a different result.
|
|||||||||||||||||||||||||||||||||||||||
Dr Jack Member Posts: 3514 From: Immigrant in the land of Deutsch Joined: Member Rating: 9.2
|
I am familiar with the evo perspective but my personal view differs somewhat. That doesn't make any sense. Mitochondrial Eve is only a meaningful concept under the evolutionary perspective. The very calculations are, like everything else in biology, saturated in evolutionary theory.
|
|||||||||||||||||||||||||||||||||||||||
Coyote Member (Idle past 2137 days) Posts: 6117 Joined:
|
quote: Perfect time to present your understanding. I am familiar with the evo perspective but my personal view differs somewhat. I don't really care what your personal view is. When we discuss science personal views don't mean anything--it is the evidence that counts. And the personal views you have been sharing with us, as pointed out by several posters, are contradicted by the evidence.Religious belief does not constitute scientific evidence, nor does it convey scientific knowledge. Belief gets in the way of learning--Robert A. Heinlein How can I possibly put a new idea into your heads, if I do not first remove your delusions?--Robert A. Heinlein It's not what we don't know that hurts, it's what we know that ain't so--Will Rogers If I am entitled to something, someone else is obliged to pay--Jerry Pournelle If a religion's teachings are true, then it should have nothing to fear from science...--dwise1 "Multiculturalism" does not include the American culture. That is what it is against.
|
|||||||||||||||||||||||||||||||||||||||
Taq Member Posts: 10085 Joined: Member Rating: 5.6 |
Yes, I used indel count of 95%, here are half a dozen papers promoting just that issue, similarity between 93% and 95%: That number is the number of bases that differ between. That is not the indel count. A single indel can cause two genomes to vary by more than 1 base. That is what you keep getting wrong. Here is yet another example using two random sequences.
Seq A: ggcaataa_____tgctcgt Seq B: ggcaataaccggatgctcgt Those sequences differ by 25% at the level of the DNA bases. They differ by 1 indel, by one mutation. If you use the base difference, your estimate of the number of indels would be 25 times too high. As sfs states, the good estimate for the indel rate is 1/7th of the substitution rate. Therefore, the number of mutations is (1.23)+(1.23/7)=1.4%. Not 5%. Edited by Taq, : No reason given.
|
|||||||||||||||||||||||||||||||||||||||
Taq Member Posts: 10085 Joined: Member Rating: 5.6 |
Perfect time to present your understanding. I am familiar with the evo perspective but my personal view differs somewhat. All you have to do is go back a few generations in your own family. Your paternal grandfather's mother (your great grandmother) contributed just as much DNA to your autosomal genome as any other great grandparent (as averaged across all births), and yet she did not give you your mitochondrial DNA. Your mothers', mother's, mother did that. So you carry a lot of DNA from other women that were not your great-grandmother responsible for your mitochondrial DNA. Edited by Taq, : No reason given. Edited by Taq, : No reason given.
|
|||||||||||||||||||||||||||||||||||||||
zaius137 Member (Idle past 3440 days) Posts: 407 Joined: |
quote: You have pointed out an inconsistency in the way I was using the Nachman and Crowell paper. You are correct about mutation rates and Percent divergence. As you have suggested mutation rate of indels is less than that for substitutions. you say about 1/7 (u). Also I have been using the wrong (k). It must only consider indels. Following is my corrections: (u) for substations is ~70 per generation. 1/7 (u) makes (u’) = 10 mutation per generation in humans for indels only. (u’) is calculated by (10/6.4x10^9 ~ 2x 10^-9). (u’) for indels is ~ 2x10^-9 A new number for (k) must be arrived at from the following:
quote: With repeats and low complexity DNA is excluded 2.37% -1.52% Gives ~.8% for human and chimp divergence concerning indels this seems low but it must be true. Subbing in for indels gives: t= number of generations since divergence (Generation =20 years)k= percentage of sequence divergence Estimated at .8% (for indels) Ne= effective size of population ~10^5 (u')=mutation rate 2 x 10^-9 (for indels) t= .5(k/u-4Ne) from Estimate of the Mutation Rate per Nucleotide in Humans | Genetics | Oxford Academic t = 1.8 million generations or 36 million years since divergence considering indels. So the HCLCA was about 36 million years ago. Edited by zaius137, : No reason given.
|
|||||||||||||||||||||||||||||||||||||||
zaius137 Member (Idle past 3440 days) Posts: 407 Joined: |
quote: Yes I can accept the consensus on this: Using this much faster mutation rate from the two studies as a basis for a new mitochondrial clock speed, Eve can be calculated to have lived a mere 6500 or 6000 years ago, rather than 200,000 years ago. http://www.mhrc.net/mitochondrial.htm
|
|||||||||||||||||||||||||||||||||||||||
zaius137 Member (Idle past 3440 days) Posts: 407 Joined: |
quote: Your presented evidence so far = 0
|
|||||||||||||||||||||||||||||||||||||||
Coyote Member (Idle past 2137 days) Posts: 6117 Joined: |
quote: Your [sic] presented evidence so far = 0 Correct, on this subject I have presented no evidence so far. This is not my field. But, as I said, other posters have presented evidence that you are wrong. And the link you had above on Mitochondrial Eve was to a creationist's website. That kind of website has no credibility in a scientific discussion as creationists are inherently anti-science. Care to try again?Religious belief does not constitute scientific evidence, nor does it convey scientific knowledge. Belief gets in the way of learning--Robert A. Heinlein How can I possibly put a new idea into your heads, if I do not first remove your delusions?--Robert A. Heinlein It's not what we don't know that hurts, it's what we know that ain't so--Will Rogers If I am entitled to something, someone else is obliged to pay--Jerry Pournelle If a religion's teachings are true, then it should have nothing to fear from science...--dwise1 "Multiculturalism" does not include the American culture. That is what it is against.
|
|||||||||||||||||||||||||||||||||||||||
zaius137 Member (Idle past 3440 days) Posts: 407 Joined: |
quote: Not knowing anything about the location or nature of the indel, you can not come to that conclusion.
quote: sfs has confused the (k) with the (u), sfs can correct me if I am wrong.
|
|
|
Do Nothing Button
Copyright 2001-2023 by EvC Forum, All Rights Reserved
Version 4.2
Innovative software from Qwixotic © 2024