Why is evolution so controversial?

All you have to do is go back a few generations in your own family. Your paternal grandfather's mother (your great grandmother) contributed just as much DNA to your autosomal genome as any other great grandparent (as averaged across all births), and yet she did not give you your mitochondrial DNA. Your mothers', mother's, mother did that. So you carry a lot of DNA from other women that were not your great-grandmother responsible for your mitochondrial DNA.Edited by Taq, : No reason given.Edited by Taq, : No reason given.

We do know what the location and nature of the indels is. It is found in the chimp genome paper. There are 5 million indels combined between the human and chimp lineages, 1/7th the number of substitutions."Through comparison with the human genome, we have generated a largely complete catalogue of the genetic differences that have accumulated since the human and chimpanzee species diverged from our common ancestor, constituting approximately thirty-five million single-nucleotide changes, five million insertion/deletion events, and various chromosomal rearrangements. . .On the basis of this analysis, we estimate that the human and chimpanzee genomes each contain 40—45 Mb of species-specific euchromatic sequence, and the indel differences between the genomes thus total ~90 Mb. This difference corresponds to ~3% of both genomes and dwarfs the 1.23% difference resulting from nucleotide substitutions; this confirms and extends several recent studies63, 64, 65, 66, 67. Of course, the number of indel events is far fewer than the number of substitution events (~5 million compared with ~35 million, respectively)."(Supplementary Information ‘Genome evolution’ and Supplementary Fig. S5)."
Initial sequence of the chimpanzee genome and comparison with the human genome - PubMedSo there are about 5 million indels with an average of ~20 bases per indel. If you change the divergence from 5% to 1.4%, this won't change anything in the calculations?Edited by Taq, : No reason given.Edited by Taq, : No reason given.Edited by Taq, : No reason given.

Already, you have a conflict. A single mutation can change 10 bases, or even 10,000 bases.

Only if modern human men mated with neanderthal women. We would only see their mitochondrial DNA if there is an unbroken chain of women from present time back to that neanderthal mother. If there is a man in that chain, the the mitochondrial DNA chain is broken. However, the rest of the neanderthal genome passed down from that neanderthal mother can still be passed down.I am sure you can find examples of how mitochondrial lineages go extinct in families that you know. All you need is a mother or grandmother who does not have any daughters or grandaughters. Over time, lineages die off which just leaves one dominant lineage.Added in edit: Always have a tough time finding this photo, but it has always been the best one for explaining the difference between mtDNA and the rest of your genome. Edited by Taq, : No reason given.Edited by Taq, : No reason given.Edited by Taq, : No reason given.Edited by Taq, : No reason given.

As you are using them, (u) and (k) do not have the same units. That's the problem. Number of mutations and number of bases changed are different units. You need to put them in the same units.

The units they are using do match since they are using number of mutations for both.

If that were so, then there would be no creationists since creationism is based purely on faith.

False. You are using two different sets of units: Mutations/generation and bases changed/generation. 1 mutation can change 1 or even 10,000 bases. Ok, let's do that:

seq A:  GCTTAGATTATTTCGAGATG
seq B:  GCTTAG_____TTCGAGATG

For a 20 base sequence, they differ by 5 bases for 75% identity. However, they only differ by 1 indel mutation. We get 25% for variance but 1 for mutation.

Why would I need faith when I have 150 years of evidence on my side?

You don't have to accept the Out of Africa model as true in order to determine the genetic outcome of that model. sfs' questions still stand."Show your work: given a plausible demographic model of the Out of Africa migration, and estimates for the amount of Neandertal admixture, calculate the probability that Neandertal mtDNA would have survived. " If active interbreeding was extremely limited then we wouldn't expect to see neanderthal mtDNA lineages in the modern population.

If the substitution rate is 70 and the indel rate is 1/7th of that, then that would be 80 mutations including both substitutions and indels, by my math.If you want to do number of bases, then the mutation rate is 10 indels with an average of 20 bases per indel, or 200 bases plus the 70 bases from substitutions. Therefore, the mutation rate should be 270 if you are using number of bases affected.For divergence, if 35 million substitutions is 1.3% divergence before adding in indels, then the divergence (in number of mutations) should be 1.3 +(1.3/7) = 1.49% for number of mutations. You can adjust this for number of bases by using the math above.Edited by Taq, : No reason given.Edited by Taq, : No reason given.

From what I have read and seen, the indel clock tends to run a bit ragged, faster at times and slower at other times. The SNP clock seems to run at a much steadier rate. This is one of the reasons that they have focused on divergence caused by substitutions, because the rate of mutations is understood a lot better. The author clearly describes them separately. For what purpose and in what context? Obviously, you can't add the number of indels directly to the number of substitutions to get the number of bases affected. 10 indels plus 70 substitutions will probably affect more than 80 bases.

Here is the legend for Table 1 of the paper:"Divergence per site between human and chimpanzee (Kimura 1980) is given for transitions (Kts) and transversions (Ktv) at CpG sites and at non-CpG sites, all single nucleotide changes (Kn), insertion-deletions (Ki), and total changes including both point mutations and insertion-deletions (Kt). Mean values are weighted by the number of sites in each locus. "They describe total changes, not total number of bases changed. They have the accession numbers for the genes they compared, so I may try to do my own alignments at a later time to show that multiple base indels are counted as single changes.Edited by Taq, : No reason given.

The problem is that you are not adding two percentages. You are adding the percentage of bases changed for substitutions to the number of indel events for your mutation rate. You need to convert the number of indel events to the number of bases changed if you want to add the two together for your mutation rate.I already did this math earlier. Indels are 1/7th the number of substitutions. If the number of substitutions is 70, then there are 10 indels. The average size of an indel is 20 bases. Therefore, the mutation rate in the units of bases changed is 70 bases from substitutions and 200 bases from indels for a total of 270.

Let's look at the chimp genome paper:"Here we present a draft genome sequence of the common chimpanzee (Pan troglodytes). Through comparison with the human genome, we have generated a largely complete catalogue of the genetic differences that have accumulated since the human and chimpanzee species diverged from our common ancestor, constituting approximately thirty-five million single-nucleotide changes, five million insertion/deletion events, and various chromosomal rearrangements."
Initial sequence of the chimpanzee genome and comparison with the human genome | NatureFor a 3 billion base haploid genome, 35 million substitutions would be 1.16%, consistent with other reports. If just 5 million indel events are added without reference to bases, this would be 40 million, or 1.33%. In order to get to the 5%, you need to transfer those 5 million indels into 90 million bases."The analysis of modest-sized insertions reveals ~32 Mb of human-specific sequence and ~35 Mb of chimpanzee-specific sequence, contained in ~5 million events in each species (Supplementary Information ‘Genome evolution’ and Supplementary Fig. S5)."
Initial sequence of the chimpanzee genome and comparison with the human genome | Nature You are all over the place. First, alleles make up a tiny portion of the overall genome. If we include regulator genes that are not translated into protein, we are only looking at 5% of the genome that has alleles. Since you seem to be referring to introns and exons, as in coding regions, then we are down to about 3% of the genome.If all we have are two species, then we can not tell if a gap is an insertion in one species or a deletion in the other. That is why they are called indels. By comparing the chimp and human genomes to the orangutan and gorilla genomes, we actually can form a consensus sequence and assign insertion and deletion status to some of the gaps. Also, why would a gap be an insertion that was previously discarded? That makes no sense.Next, a 5 bp gap is not considered to be 5 separate 1 base indels. It is considered a single 5 bp indel. It is considered a single event, not 5 individual events. This is based on the rule of parsimony which requires you to have the fewest mutations necessary to reach a consensus sequence. This is the same rule for substitutions. If we see a T substituted for an A, we don't assume that it changed to a G, then a C, then a T, then an A, and then finally a T. Instead, it assumes one mutation, from an A to a T. Then why does Table 1 from their paper include indels? I don't see why they wouldn't be included. The problem is that rare but large indels can really skew the data. For the human and chimp divergence, the rare but large indels account for a hefty portion of the differences while small but plentiful indels account for less of the differences."Analysis of the completely covered insertions shows that the vast majority are small (45% of events cover only 1 base pair (bp), 96% are <20 bp and 98.6% are <80 bp), but that the largest few contain most of the sequence (with the ~70,000 indels larger than 80 bp comprising 73% of the affected base pairs) (Fig. 5). "
Initial sequence of the chimpanzee genome and comparison with the human genome | NatureThis means that you need a very large pool of direct sequencing of family trios to adequately cover the observed occurrence of these rare but important indels. We simply don't have those direct observations. It's as if everything we say is just ignored. 10 indel mutations would be 200 base pairs. It would be 80 new mutations, and 270 base pairs. Like I said, it's as if what we say goes in one ear . . .Edited by Taq, : No reason given.