What exactly is ID?

SO, your ENTIRE argument hinges on this one bit of one sentence:"out of ALL possible combinations that the universe could be existing in, we just happen to be living in _one_ that evolution works in, by _chance_!"I've highlighted 2 words. "One" and "Chance".Now I'm going to demonstrate for you why you are wrong - ON MULTIPLE levels.A) You can not show that there is only 1 Universe in which evolution works. For all you know it could work in ALL of them, or HALF of them, or 8% of the them.Your entire conclusion rests on the idea that it only works in ONE of them. That's a HUGE and EXTREMELY UNFOUNDED assumption and it NEGATES everything you've proposed.And that's assuming that life AS WE KNOW IT is the ONLY possible was things could have happened. That's not even a proper conclusion for OUR OWN Universe, much less a multiverse.B) BUT! Even IF we say that A is right. Even IF we conclude that there are a hundred billion billion billion Universes in out of all of them, evolution only works in EXACTLY one of them. Your evaluation that "we just happen to be living in it" is the Sharpshooter Fallacy.OF COURSE we are living in the one where it works! If we weren't WE wouldn't be having the conversation. Instead the people FROM THAT UNIVERSE would be having the conversation and they would be saying the EXACT SAME THING.It's the puddle saying "How amazing is it that I found a pothole that fits me perfectly?!"If Evolution ONLY works in ONE UNIVERSE, then THAT IS THE UNIVERSE where the people will question why evolution only works there. ALL OTHER UNIVERSES won't have the conversation because they won't know to have it.This is a HUGE flaw in your argument. If you choose to ignore it, we'll know that you aren't here to honestly discuss the topic, but are rather just preaching your personal dogma unable or unwilling to see the errors.

Now you're just demonstrating your own ignorance of your side of the debate.12-24-07
Interview with Dembski.
Here's the link: OREGON: Ask Governor Kate Brown to Veto Legislation Mandating LGBT Content in ALL School History, Geography, Economics and Civics Curriculums | Family Policy Alliance
Here's the Question and Answer: So, WERE YOU WRONG about WHAT DEMBSKI SAYS?YES or NO?By the way, I'll be asking this question over and over until I get an answer. Just an FYI.Edited by Nuggin, : No reason given.

quote:

---

Hi Smooth Operator,

​

Hopefully you have seen Message 353. If not please give it a read.

​

The goal of EvC Forum is productive, informative, on-topic discussion in a civil fashion. This is the last warning. After this point I'll be issuing 24 hour suspensions to those in this thread who seem to be working against this goal. Those who think they may have posted in violation should go back and edit any suspect messages before I see them.

---

No problem. I just hope you alo notice other posts, not just mine...

quote:

---

How exactly can you "see" functions without testing for them ?

---

Some kind of function would be noticed. A catalisys or something similar.

quote:

---

Even if that is true it doesn't change the fact that we aren't arguing over the definition. You just refuse to apply it.

---

The point is that you don't even know the definition of Specification. Yet you want to argue about it with me. Nevetheless, let me give you the definition right from TDI.A specification is:Given an event E, a pattern D, and a requisite precondition Σ = (H, P, I, Φ = (φ, λ)), we say that D is a specification of E relative to Σ(or equivalently that D specifies E relative to Σ) if and only if the following conditions are satisfied:CINDE P(E|H&J) = P(E|H) for any information J generated by I.
TRACT φ(D|I) < λ.
DELIM D delimits E.This is the full definition. Now I want you to show that you understood even a bit of this, and that I'm not arguing in vane.Tell me what is CINDE, TRACT and DELIM.

quote:

---

Of course you haven't bothered to actually give your specification. All I know is that it includes either the protein or the gene sequences for the 50 proteins in the E Coli flagellum, modified by a factor that is supposed tollow for the 20% variation allowed by Axe.

---

That's not a specification! The specification is a pattern that describes another pattern. "Bidirectional rotary motor-driven propeller" is the specification.

quote:

---

It mean that you have to calculate the number of sequences that are no more than 20% different from each of the 50 proteins or genes (whichever Axe used) that make up the E Coli flagellum. Or you could do the sensible thing and give up - because even if you include the correct factor the whole calculation doesn't do you any good anyway.

---

Look, if you have an equation like this 1+2+3+4 = 10. you get the same result if you subtract 20% of each number on the left side, or if you subtract just once 20% on the right side. When I subtracted 20% of Dembski's original number, I did the same thing you are telling me now to do. To take away 20% of every individual protein. I did just that, but with one shot.

quote:

---

You are wrong again. If TDI really is on google books you ought to read and understand it. Then you might not keep making so many mistakes. Or maybe not, because you will find sections of it harder to read than anything I've written.

​

Anyway, you can't have CSI without a specification. The information content belongs to the specification not the particular event. So if the only valid specification you have includes both flagella - as is the case - then the only CSI you have is the same for each.

---

If the complexity is different, than the calcualtion is different too. We can't iclude a flagellum that i composed of 50 proteins and some hypothetical one that is composed of 100 proteins and call them the same amount of CSI.

quote:

---

Salt crystals DON'T have the form of a face-centred cubic lattice ? This will be news to a lot of crystallographers.

---

None of them has an identical pattern. They are all similar, but they do not represent a specification. Because you can't use that information to describe a particular salt srystal. You also have to be able to do that.

quote:

---

So we have to go to the origins of the origins of the mechanisms that grow the flagellum now ? That's OK by me. Produce your specification and get calculating.

---

We should if we are interested in how those mechanisms came about. But we are not interested in it now. We are only concerned witht he flagellum.

quote:

---

By not using a valid specification, nor taking all possible explanations into account. Both are mandatory in TDI.

---

I can't wait for your next post. I would really like to see what you will claim all those things I asked you about specification are.

quote:

---

One example - especially where the beneficial nature of the mutation is highly qualified - is not sufficient to prove a universal claim. Especially when the claim itself is so vague and wooly.

---

Yes I know it's one example. There are many more. I'm just saying that just by having beneficial mutations, you are not stopping genetic entropy.

quote:

---

The only way that the can be truly invisible is to have no effect. That is a simple fact. By definition any deleterious mutation reduces fitness. By definition lower fitness means that the average number of offspring will be lower. And lower fitness individuals producing fewer offspring IS natural selection.

---

Wrong! If natural selection had PERFECT sensitivity than you would be right! But it doesn't. There is lot's of noise that gets in the way of natural selection. So slightly deleterious mutations get by.

quote:

---

The graph shows no such thing. All it shows is that there are many more nearly neutral mutations then strongly deleterious mutations. That doesn't contradict my views in the slightest. In fact it's exactly what I predicted.

---

The shaded area represents those mutations that natural selection can not detect!

quote:

---

At the present time I have no reason to think that Motoo Kimura agrees with your ideas of genetic entropy. If you could produce a genuine quotation which showed that he did I would take the idea a lot more seriously.

---

Here you go.

quote:

---

According to Kimura, when one compares the genomes of existing species, the vast majority of molecular differences are selectively "neutral." That is, the molecular changes represented by these differences do not influence the fitness of the individual organism. As a result, the theory regards these genomic features as neither subject to, nor explicable by, natural selection.

---

Neutral theory of molecular evolution - WikipediaEdited by Smooth Operator, : No reason given.

quote:

---

Sort of like when you have a hard drive with 100mb of data and you add another 1mb of data, you've seriously reduced the amount of data by -1%.

​

You can't have it both ways SO. Either adding a new "good" mutation is ADDING or it's SUBTRACTING. Those two words, being opposite, can't mean the same thing.

---

No, wrong. You obviously have no idea about this. Deleterious mutations reduce fitness. Beneficial mutations increase fitness. But both deleterious and beneficial mutations degrade information in the genome. Fitness is not proportionally connected to biological functions. You simply don't get this.

quote:

---

SO, your ENTIRE argument hinges on this one bit of one sentence:

---

I think I wrote a lot more than that...

quote:

---

A) You can not show that there is only 1 Universe in which evolution works. For all you know it could work in ALL of them, or HALF of them, or 8% of the them.

---

That's true, there could be an infinite amount of universes. But do you have any evidence for that? Is it reasonable to invoke an infinite amount of universes as opposed to one intelligence? How scientific is it to invoke something like that? Is that even falsifiable? Could you not invoke an infinite amount of universes for ALL explanations, and simply claim that everything is a product of chance because there are infinite amounts of universes, and we just happen to be in the one that the observed event happened. Sorry, that's not reasonable. A much better explanation is one single invokation of an intelligent cause.

quote:

---

Your entire conclusion rests on the idea that it only works in ONE of them. That's a HUGE and EXTREMELY UNFOUNDED assumption and it NEGATES everything you've proposed.

---

Wrong. I never said that. I simply said that we know of this universe and that we don't know of any other one. If you are going to invoke an infinite amount of universes to get by your problem, than that's just not a good scientific answer. Maybe it would be a good philosophical one, but not scientific one.

quote:

---

And that's assuming that life AS WE KNOW IT is the ONLY possible was things could have happened. That's not even a proper conclusion for OUR OWN Universe, much less a multiverse.

---

What?

quote:

---

B) BUT! Even IF we say that A is right. Even IF we conclude that there are a hundred billion billion billion Universes in out of all of them, evolution only works in EXACTLY one of them. Your evaluation that "we just happen to be living in it" is the Sharpshooter Fallacy.

​

OF COURSE we are living in the one where it works! If we weren't WE wouldn't be having the conversation. Instead the people FROM THAT UNIVERSE would be having the conversation and they would be saying the EXACT SAME THING.

​

It's the puddle saying "How amazing is it that I found a pothole that fits me perfectly?!"

​

If Evolution ONLY works in ONE UNIVERSE, then THAT IS THE UNIVERSE where the people will question why evolution only works there. ALL OTHER UNIVERSES won't have the conversation because they won't know to have it.

​

This is a HUGE flaw in your argument. If you choose to ignore it, we'll know that you aren't here to honestly discuss the topic, but are rather just preaching your personal dogma unable or unwilling to see the errors.

---

No, you are assuming that evolution really did produce people. Your conclusion is that since we are here, evolution must be true. That's a logical fallacy. We could be here for any other reason. We do not know how we got here.The point remains that you can't invoke an infinite amount of universes and claim that it's a beter explanation than one intellignet causation. Because your proposition is not falsifiable. It's a philosophical position, not a scientific one.Yes, I agree, maybe there really is an infinite amount of universes, and we just happen to live in one in which evolution produced us. Could be. But that statement is a philosophical one, since it's not falsifiable.And we should stick to science in this discussion not philosophy.

quote:

---

So, WERE YOU WRONG about WHAT DEMBSKI SAYS?

​

YES or NO?

​

By the way, I'll be asking this question over and over until I get an answer. Just an FYI.

---

No I wasn't. I told you already once before. When Dembski get's interviewed, and I specifically mentioned that, he always claims that his personal belief is that God is the designer. But he never says that ID is proof for that, or that ID is trying to prove that. It's just his personal belief.And his next quote proves that, why did you not include it?

quote:

---

The focus of my writings is not to try to understand the Christian doctrine of creation; it’s to try to develop intelligent design as a scientific program.

---

See? His job is NOT to prove Christianity right. It's to do science.

You are, of course, lying. I have.Let's do it again.When the population is big enough that the fixation rate of beneficial mutations is greater than the fixation rate of deleterious mutations, then genetic meltdown will not occur. You are, of course, lying. Where I said: "When the population is big enough that the fixation rate of beneficial mutations is greater than the fixation rate of deleterious mutations, then genetic meltdown will not occur." You are, of course, lying. And yet it is you who has been forced to backpedal from your original delusion that everyone had a different definition. You are, of course, lying. See my post #165, where I explain the No Free Lunch Theorem. You are, of course, lying. No, of course not. What made you ask such a stupid question? The ones that I have pointed out to you. You are, of course, lying. In my case it's rather less vague. No, of course not. What made you ask such a stupid question? And you are, of course, wrong. This is, of course, not true. It doesn't actually take "all day long" to laugh at your childish errors. I have replied. Specifically, I have told you to study the No Free Lunch Theorem until you know what it says.There is no point in trying to discuss the subject with you when you don't even know what the subject is.Edited by Dr Adequate, : No reason given.Edited by Dr Adequate, : No reason given.Edited by Dr Adequate, : No reason given.

Sorry, SO, but you are the one that is lost."Information" in this context is really nothing more than the LENGTH of the sequence. MORE length = MORE information.There is no value placed on the quality of the information, just the quantity.In THAT case, ANY mutation which ADDS length (duplication, repetition, mirroring, simple addition) ADDS information. And ANY mutation which SHORTENS length (merging, truncating, simple subtraction) REDUCES information.AMOUNT of information is NOT an evaluation of fitness. An individual could have twice the information as another and be less fit (or more fit) depending on WHAT that information encodes.So, ADDING mutations does NOT necessarily result in extinction as your premise concludes, because mutations don't necessarily INCREASE or DECREASE information. They change it. Some increase, some decrease, some do nothing.Then FITNESS weeds out those which can not compete with NO ATTENTION whatsoever to amount of information. Fitness couldn't care less who has more or less. Just which is best fit.So, where EXACTLY does Genetic Entropy fit in? It doesn't. Which is completely consistent with the very real observation (given that THINGS ARE HERE) that it DOESN'T ACTUALLY EXIST. Hate to kick you when you are down, but YOU are the one arguing that there are MANY universes and that we exist in this one as a result of some great Creator's wish. You can't ALSO argue that claiming that there are many universes is invalid.You have to PICK and argument and stick to it. You don't get to play both sides at the same time.So, which is it? Are you WRONG because there AREN'T a lot of Universes or are you WRONG because there ARE? It is rare that I see someone fail THIS hard.You DON'T explain WHY it is not reasonable to assumes that there are multiple universes (a claim which YOU YOURSELF posted btw) -NOR- do you explain why "a much better explanation" is the invoking of the Magic Jew Wizard. (oh wait, that's right, you don't like it when I point out that you're talking about Dembski's Christian Fundamentalist God. Sorry, the Non--denominational Wizard). Let's review:DID YOU WRITE THIS? (Hint: YES!) "Out of ALL possible combinations that the universe could be existing in, we just happen to be living in the ONE that evolution works in, by chance"
"...the ONE that evolution works in..."
"...the ONE..."
"...ONE..."In the quotes above, can you please point out where you are NOT SAYING "ONE".You can start with the last quote and work up, if that's easiest for you.Tip: Don't lie about what you posted on a forum where people can scroll up. I'll repeat it, but really you can just re-read it if you don't understand. Still, I want to be helpful so here, I'll repeat it 3 more times.And that's assuming that life AS WE KNOW IT is the ONLY possible way things could have happened. That's not even a proper conclusion for OUR OWN Universe, much less a multiverse.And that's assuming that life AS WE KNOW IT is the ONLY possible way things could have happened. That's not even a proper conclusion for OUR OWN Universe, much less a multiverse.And that's assuming that life AS WE KNOW IT is the ONLY possible way things could have happened. That's not even a proper conclusion for OUR OWN Universe, much less a multiverse.That better? Fail. Again.My conclusion is that WHICH EVER universe intelligent life exists in, they are going to be able to conclude that THEIR UNIVERSE contains intelligent life.However since Universes which DON'T contain intelligent life AREN'T having the conversation, you can't conclude that we are special because we exist in one where we CAN have it. If we didn't, we couldn't and it would be a moot point. HOW EXACTLY is your claim falsifiable?You are the one critiquing. You are the one who started the line of argument.Go ahead, describe for us the experiment which we can run which falsifies your non-denominational wizard juice claim? First of all, that NOT what that sentence concludes and I suspect that you know that.Second of all, if his "JOB" is to do science, why is it that he's NEVER done it?YOU JUST SAID that the claim has to be falsifiable. Do I need to QUOTE you again within the same post? Are you going to lie and say that you didn't say that either. Just scroll up and read your own words.Tell us EXACTLY what experiments Dembski has done or even suggested which would falsify HIS "Jew Wizard" claims. (Note: Dembski believes it is a Jew wizard, even if you still think he's non-denominational).Edited by Nuggin, : No reason given.

quote:

---

Some kind of function would be noticed. A catalisys or something similar.

---

How exactly would it be noticed without even attempting to measure it ?

quote:

---

The point is that you don't even know the definition of Specification. Yet you want to argue about it with me.

---

We're not arguing about the definition of specification.

quote:

---

A specification is:

​

Given an event E, a pattern D, and a requisite precondition Σ = (H, P, I, Φ = (φ, λ)), we say that D is a specification of E relative to Σ(or equivalently that D specifies E relative to Σ) if and only if the following conditions are satisfied:

​

CINDE P(E|H&J) = P(E|H) for any information J generated by I.
TRACT φ(D|I) < λ.
DELIM D delimits E.

​

This is the full definition. Now I want you to show that you understood even a bit of this, and that I'm not arguing in vane.

​

Tell me what is CINDE, TRACT and DELIM.

---

If you understood that, then you can't have any problems with anything that I've written ! And I note that you have chosen to quote from a page which is not on Google books, knowing that I do not have access to my copy of the book, and therefore cannot see the full context. (Notably the definitions of some of the terms are missing from your quote)CINDE, the independence condition requires that the background information that we use to construct the specification must not directly or indirectly give us reason to think that the pattern is more likely occur than otherwise.TRACT, the tractability requires that given D you must be able to reasonably reconstruct the specification using ONLY the background information, not the event itself.If I remember correctly, DELIM, the delimeter condition requires that the specification fully includes the actual event.

quote:

---

That's not a specification! The specification is a pattern that describes another pattern. "Bidirectional rotary motor-driven propeller" is the specification.

---

You see, we aren't arguing ! You just agreed that I am correct !So now you have to go back and do the calculations for "Bidirectional rotary motor-driven propeller". Good luck !

quote:

---

Look, if you have an equation like this 1+2+3+4 = 10. you get the same result if you subtract 20% of each number on the left side, or if you subtract just once 20% on the right side. When I subtracted 20% of Dembski's original number, I did the same thing you are telling me now to do. To take away 20% of every individual protein. I did just that, but with one shot.

---

That's not what I told you to do.Here's a simple example. Consider a sequence of 5 coin tosses. The probability of getting 5 heads is 1/32. Any sequence with 1 tail and 4 heads will be 20%$ different.So how do we calculate the probability of getting a sequence no more than 20% different ?We don't add 20% (which gets us a probability of 0.0375 (3/80)We don't ignore 1 of the coin tosses (which gives us a probability of 1/16)What we do is count ALL the sequences that fall in that range (1 with 5 heads and 5 with 1 tail and 4 heads) and add up their probabilities. (And that is 3/16).You have to do the equivalent of the last. Or, as I said, you can spend your time productively instead of fixing an error in a calculation which is of no uuse to you anyway.

quote:

---

If the complexity is different, than the calcualtion is different too.
We can't iclude a flagellum that i composed of 50 proteins and some hypothetical one that is composed of 100 proteins and call them the same amount of CSI.

---

Sure you can, if the specification fits both. Remember the complexity is the probability of meeting the specification, so if both flagella meet the specification you have to use the probability of getting either one.

quote:

---

None of them has an identical pattern. They are all similar, but they do not represent a specification. Because you can't use that information to describe a particular salt srystal. You also have to be able to do that.

---

We can't fully describe an imperfect salt crystal with the specification - but that is because it is NOT a fabrication. The specification is not meant to include chance variations - and if it does then it must be a fabrication.In fact if you look at Dembski's handling of the Caputo case you will see that his specification does NOT fully specify the sequence of results. So I guess that Dembski doesn't think that the specification needs to fully describe the event any more than I do.

quote:

---

We should if we are interested in how those mechanisms came about. But we are not interested in it now. We are only concerned witht he flagellum.

---

You keep changing your mind ! First you want to calculate the information in those mechanisms and now you don't.Well OK, if you only want to look at the flagellum we're back to the fact that the bacterium grows the flagellum with very high probability.

quote:

---

Yes I know it's one example. There are many more. I'm just saying that just by having beneficial mutations, you are not stopping genetic entropy.

---

The point that you were meant to be supporting was that all beneficial mutations damaged genetic information. But you can't show that with cherry-picked examples.As for your "Kimura quote", which I repeat: If you think that it supports your ideas about genetic entropy, you are sadly mistaken. It says nothing about genetic meltdown at all.
In fact it explicitly says that the mutations it refers to are strictly neutral (a simplification to be sure, but one which renders the whole quote useless to you because it does not even address the issue of slightly deleterious mutations).

He doesn't think that that is his job. As he admits: His job is to dupe the mathematically illiterate into thinking that he's proved something.

You're not the only offender, but to use my favorite analogy, the police do not usually pay much attention to drivers going 70, especially when there are others going 100.In metric: The police do not usually pay much attention to drivers going 110, especially when there are others going 160.This is not the Autobahn, so please maintain a reasonable level of conformance with the Forum Guidelines or your privileges for driving on this road might become endangered.Please, everyone, no replies.

---

--	Percy
	EvC Forum Director

quote:

---

You are, of course, lying.

---

You know that's not true.

quote:

---

I have.

​

Let's do it again.

​

When the population is big enough that the fixation rate of beneficial mutations is greater than the fixation rate of deleterious mutations, then genetic meltdown will not occur.

---

If that's your explanation than fine. I'll remember that, and so should you.Now to tell you why you're wrong. Deleterious mutations cause genetic entropy just as much as beneficial ones do. A perfect example is the sickle cell mutation. It's considered a beneficial mutation, yet it degrades the genetic information, by reducing the functionality of the red blood cells. They are less efficient in transporting oxygen. If you read Sanford's "Genetic Entropy" you would have known that.Almost all mutationsreduce genetic information, regardless of them being beneficial or not. Fitness is not proportionally correlated with biological functions. One can go up, and the other go down. Genetic entropy is not about fitness, it's about biologic information.

quote:

---

You are, of course, lying.

---

Now youa re the one who is lying about me.

quote:

---

And yet it is you who has been forced to backpedal from your original delusion that everyone had a different definition.

---

I still maintain that. Wehn I say "everyone" I do not mean 100% of world's population.

quote:

---

The ones that I have pointed out to you.
You are, of course, lying.
In my case it's rather less vague.
No, of course not. What made you ask such a stupid question?
And you are, of course, wrong.
This is, of course, not true.
It doesn't actually take "all day long" to laugh at your childish errors.

---

No.

quote:

---

I have replied. Specifically, I have told you to study the No Free Lunch Theorem until you know what it says.

​

There is no point in trying to discuss the subject with you when you don't even know what the subject is.

---

So you refuse to reply to what I have said. Fine. I didn't expect anythign else.

quote:

---

Sorry, SO, but you are the one that is lost.

​

"Information" in this context is really nothing more than the LENGTH of the sequence. MORE length = MORE information.

​

There is no value placed on the quality of the information, just the quantity.

---

If you define the biologic information as Shannon information than that would be true. But that is not an adequate description. Becasue different sequences have different meaning. They have different biological functions. A vast majority of sequences are totally meaningless to biology. The represent no biologic functions. Only a tiny minority of all possible sequences represent biological functions.Therefore, it's not just about length. It's about their structure, and how they are placed, one nucleotide after the other. Gentic code is similar to human language. Some words have meaning, some don't. The same goes for DNA.Let me give you an example:"TODAY IS A NICE DAY"
"AAAAAAAAAAAAAAAAAAA"If we defined these statements as Shannon Information they would be identical because they are both 19 letters long including spaces. But surely they are not identical. One has a meaning when interpreted with English language, and the other has none. The same goes for the DNA.Hypothetically one sequence could look like this, and another one below it like this:"TCAGATAGCCGATATCGGAGATCGAT"
"TTTTTTTTTTTTTTTTTTTTTTTTTT"Now the upper one could for an example coed for some protein. The lower one, would code for nothing. When interpreted by the standard genetic code, the ribosome would not produce a viable protein. Why? Well, because the protein would not fold correctly, and it would produce no function whatsoever. And it would be broken apart by the mechanisms in the cell that do that to proteins that don't work.Therefore, it's not just about length, it's about the sequence.

quote:

---

In THAT case, ANY mutation which ADDS length (duplication, repetition, mirroring, simple addition) ADDS information. And ANY mutation which SHORTENS length (merging, truncating, simple subtraction) REDUCES information.

---

Yes, if you defined it as Shannon information. But that's a false definition in this case. You can use Shannon information to tell you how much stuff you have on your HDD. It doesn't matter to you what you have, you just want your HDD to tell you how much space you have taken up. Therefore, when you fill up 10 GB of space, you are going to see a number of 10 GB used. Regardless of that information being a 10 GB text file of random letters. Or 10 GB of DivX movies.Yet in other cases, you would certainly not want to use Shannon information, to measure inforamtion. Becasue it's not applicable.This article explains it very well, please do read it.

quote:

---

Shannon information theory measures the relative degrees of RSC and OSC. Shannon information theory cannot measure FSC. FSC is invariably associated with all forms of complex biofunction, including biochemical pathways, cycles, positive and negative feedback regulation, and homeostatic metabolism. The algorithmic programming of FSC, not merely its aperiodicity, accounts for biological organization. No empirical evidence exists of either RSC of OSC ever having produced a single instance of sophisticated biological organization.

---

Three subsets of sequence complexity and their relevance to biopolymeric information - PMC

quote:

---

AMOUNT of information is NOT an evaluation of fitness. An individual could have twice the information as another and be less fit (or more fit) depending on WHAT that information encodes.

---

Exactly. That is why I am right, and you have just contradicted yourself. First you said that it's only about length, and now you are basicly agreeing with me, in sayign that's it's about the sequence, not just length.

quote:

---

So, ADDING mutations does NOT necessarily result in extinction as your premise concludes, because mutations don't necessarily INCREASE or DECREASE information. They change it. Some increase, some decrease, some do nothing.

---

Exactly. But on average, they decrease it. Regardless of the mutation being beneficial or deleterious. Because DNA is not a random piece of sequence. And any random change will on average destroy teh sequence. Simply becasue of teh probability. It's a much higher probability that we will get a non functional than a functional sequence by random mutations.

quote:

---

Then FITNESS weeds out those which can not compete with NO ATTENTION whatsoever to amount of information. Fitness couldn't care less who has more or less. Just which is best fit.

---

Exactly that! Yes, and that is why genetic entropy is happening. Precisely because of that. That is why somethign liek sickle cell mutation causes a degradation in biologic functions, by reducing the functionality of red blood cells, yet it's a beneficial mutation that gets selected for. And as such these degradations of genome accumulate. Becasue as I said earlier, fitness and biological functions, are not correlated proportionally.

quote:

---

So, where EXACTLY does Genetic Entropy fit in? It doesn't. Which is completely consistent with the very real observation (given that THINGS ARE HERE) that it DOESN'T ACTUALLY EXIST.

---

To bad you came to the wrong conclusion in teh end.

quote:

---

Hate to kick you when you are down, but YOU are the one arguing that there are MANY universes and that we exist in this one as a result of some great Creator's wish. You can't ALSO argue that claiming that there are many universes is invalid.

​

You have to PICK and argument and stick to it. You don't get to play both sides at the same time.

​

So, which is it? Are you WRONG because there AREN'T a lot of Universes or are you WRONG because there ARE?

---

No I'm not. I said that the only way out of the Vertical NFL problem is to claim that there is an infinite amount of universes. I'm only claimign that this one exists.

quote:

---

It is rare that I see someone fail THIS hard.

​

You DON'T explain WHY it is not reasonable to assumes that there are multiple universes (a claim which YOU YOURSELF posted btw) -NOR- do you explain why "a much better explanation" is the invoking of the Magic Jew Wizard. (oh wait, that's right, you don't like it when I point out that you're talking about Dembski's Christian Fundamentalist God. Sorry, the Non--denominational Wizard).

---

Becasue we have evidence for only one universe. And because it's not falsifiable. Therefore, it's philosophy, not science. And becasue such an explanation can explain anything by chance. And a theroy that explains everything, explains nothing. On teh other hand, we invoke intelligence, which is a known cause that produces CSI, and we can falsify it. Soemthing that can be explained by either chance within this universe, or by regularity, falsifies the design hypothesis. On teh otehr hand, you can claim that ANYTHING is the way it is, just because we are in such a universe. It's unfalsifiable, therefore, not a good scientific explaantion, it's a philosophical argument.

quote:

---

"Out of ALL possible combinations that the universe could be existing in, we just happen to be living in the ONE that evolution works in, by chance"
"...the ONE that evolution works in..."
"...the ONE..."
"...ONE..."

​

In the quotes above, can you please point out where you are NOT SAYING "ONE".

​

You can start with the last quote and work up, if that's easiest for you.

​

Tip: Don't lie about what you posted on a forum where people can scroll up.

---

The point is that it is one of those that it works in. But it could be only one for that matter. It doesn't make any difference, because if you invoke the multiverse, you have an infinite amount of universes to pick from, so we would have to be in the one in which evolution works.

quote:

---

I'll repeat it, but really you can just re-read it if you don't understand. Still, I want to be helpful so here, I'll repeat it 3 more times.

​

And that's assuming that life AS WE KNOW IT is the ONLY possible way things could have happened. That's not even a proper conclusion for OUR OWN Universe, much less a multiverse.

​

And that's assuming that life AS WE KNOW IT is the ONLY possible way things could have happened. That's not even a proper conclusion for OUR OWN Universe, much less a multiverse.

​

And that's assuming that life AS WE KNOW IT is the ONLY possible way things could have happened. That's not even a proper conclusion for OUR OWN Universe, much less a multiverse.

​

That better?

---

It could be 3, 4, 10, 1000, or 10000000000 universes. It doesn't matter. By invoking a multiverse you are artificially inflating your probabilistc resources. It doesn't matter how many of tehm you invoke, or in how many evolution works in. The point is that you simply invented a multiverse to explain a problem by apeal to chance.

quote:

---

Fail. Again.

​

My conclusion is that WHICH EVER universe intelligent life exists in, they are going to be able to conclude that THEIR UNIVERSE contains intelligent life.

​

However since Universes which DON'T contain intelligent life AREN'T having the conversation, you can't conclude that we are special because we exist in one where we CAN have it. If we didn't, we couldn't and it would be a moot point.

---

But we are special since we do exist. I don't care that other universes are not having this conversation. That's their problem.

quote:

---

HOW EXACTLY is your claim falsifiable?

​

You are the one critiquing. You are the one who started the line of argument.

​

Go ahead, describe for us the experiment which we can run which falsifies your non-denominational wizard juice claim?

---

Explanatory filter. Described it many times.

quote:

---

First of all, that NOT what that sentence concludes and I suspect that you know that.

---

Uh, yes it does.

quote:

---

Second of all, if his "JOB" is to do science, why is it that he's NEVER done it?

---

Did you read TDI or NFL? Nope. So why claim he never did science?

quote:

---

YOU JUST SAID that the claim has to be falsifiable. Do I need to QUOTE you again within the same post? Are you going to lie and say that you didn't say that either. Just scroll up and read your own words.

---

Yes, and ID is falsifiable. The explanatory filter, read up.

quote:

---

Tell us EXACTLY what experiments Dembski has done or even suggested which would falsify HIS "Jew Wizard" claims. (Note: Dembski believes it is a Jew wizard, even if you still think he's non-denominational).

---

Why are constantly lying? I said many times that he is a Christian and that he believes in the Christian God? Did I ever said that he doesn't?Edited by Smooth Operator, : No reason given.

quote:

---

How exactly would it be noticed without even attempting to measure it ?

---

You don't measure it, you notice a process that is going on.

quote:

---

We're not arguing about the definition of specification.

---

Obviously we are since you are claiming that I'm not using Dembski's definition.

quote:

---

If you understood that, then you can't have any problems with anything that I've written ! And I note that you have chosen to quote from a page which is not on Google books, knowing that I do not have access to my copy of the book, and therefore cannot see the full context. (Notably the definitions of some of the terms are missing from your quote)

---

Nope. I choose that definition without knowing which pages are missing on google books. The page where specification is defined is where I wuoted from. If that page is missing at google books, than I'm sorry about that, but what can I do... And no, it's an exact quote, I left out nothing.

quote:

---

CINDE, the independence condition requires that the background information that we use to construct the specification must not directly or indirectly give us reason to think that the pattern is more likely occur than otherwise.

​

TRACT, the tractability requires that given D you must be able to reasonably reconstruct the specification using ONLY the background information, not the event itself.

​

If I remember correctly, DELIM, the delimeter condition requires that the specification fully includes the actual event.

---

Fine, you passed the test. At least now I know, I'm not totally wasting my time with you.

quote:

---

You see, we aren't arguing ! You just agreed that I am correct !

​

So now you have to go back and do the calculations for "Bidirectional rotary motor-driven propeller". Good luck !

---

I already did.

quote:

---

That's not what I told you to do.

​

Here's a simple example. Consider a sequence of 5 coin tosses. The probability of getting 5 heads is 1/32. Any sequence with 1 tail and 4 heads will be 20%$ different.

​

So how do we calculate the probability of getting a sequence no more than 20% different ?

​

We don't add 20% (which gets us a probability of 0.0375 (3/80)

​

We don't ignore 1 of the coin tosses (which gives us a probability of 1/16)

​

What we do is count ALL the sequences that fall in that range (1 with 5 heads and 5 with 1 tail and 4 heads) and add up their probabilities. (And that is 3/16).

​

You have to do the equivalent of the last. Or, as I said, you can spend your time productively instead of fixing an error in a calculation which is of no uuse to you anyway.

---

What I did already included all sequences that are no more than 20% different. If not, than tell em what is the difference between your method and mine.

quote:

---

Sure you can, if the specification fits both. Remember the complexity is the probability of meeting the specification, so if both flagella meet the specification you have to use the probability of getting either one.

---

And I did that for the bacterial flagellum of E. Coli. If other flagella have a different complexity, than they haev a different amoutn of CSI.

quote:

---

We can't fully describe an imperfect salt crystal with the specification - but that is because it is NOT a fabrication. The specification is not meant to include chance variations - and if it does then it must be a fabrication.

---

You can't detach the patternt of a salt crystal. Meaning, you can only describe it by looking at the crystal itself. Therefore, it's not a spcification. If you could describe the pattern the salt crystal exhibited without looking at the crystal itself, than it would be a specification.

quote:

---

In fact if you look at Dembski's handling of the Caputo case you will see that his specification does NOT fully specify the sequence of results. So I guess that Dembski doesn't think that the specification needs to fully describe the event any more than I do.

---

"Selecting Democrats over Republicans 40 out of 41 times in ballots" describes the event perfectly.

quote:

---

You keep changing your mind ! First you want to calculate the information in those mechanisms and now you don't.

​

Well OK, if you only want to look at the flagellum we're back to the fact that the bacterium grows the flagellum with very high probability.

---

I knwo it gorws with high probability! But that does nto account for the flagellum's DNA! It's there without it growing or not. How did it get there?

quote:

---

The point that you were meant to be supporting was that all beneficial mutations damaged genetic information. But you can't show that with cherry-picked examples.

---

I didn't say all! I said almost all mutations degrade genetic information. On average they degrade the information, therefore, the chances are higher that they will degrade it when a mutation happens. And since natural selection is not perfect, they will accumulate. That is my argument.

quote:

---

If you think that it supports your ideas about genetic entropy, you are sadly mistaken. It says nothing about genetic meltdown at all.
In fact it explicitly says that the mutations it refers to are strictly neutral (a simplification to be sure, but one which renders the whole quote useless to you because it does not even address the issue of slightly deleterious mutations).

---

My argument was that Kimura said that slightly deleterious/nearly neutral mutations are invisible to natural seelction. And that's true.Look at teh last statement: "As a result, the theory regards these genomic features as neither subject to, nor explicable by, natural selection."

quote:

---

You don't measure it, you notice a process that is going on.

---

And how exactly can you do that without testing for it ?

quote:

---

Obviously we are since you are claiming that I'm not using Dembski's definition.

---

Since you agree with me that the specification you are actually using is a fabrication it is obvious that we are NOT disagreeing on the definition. In fact all that is going on is that you are stubbornly insisting on using a definition you know to be a fabrication.

quote:

---

Nope. I choose that definition without knowing which pages are missing on google books. The page where specification is defined is where I wuoted from. If that page is missing at google books, than I'm sorry about that, but what can I do... And no, it's an exact quote, I left out nothing.

---

What I said was missing was context, and that is entirely correct. An exact quote can still be missing context (and often is).

quote:

---

I already did.

---

Quite frankly I have every reason to believe that that is not even possible. I don't believe that it would be possible even if you had examined all the other flagella where the structure is known.Further all the calculations you have talked about have been expressly based on the E Coli flagellum structure, and therefoe used a different specification.However, you deserve the opportunity to show that you have done the work. Please produce your working.

quote:

---

What I did already included all sequences that are no more than 20% different. If not, than tell em what is the difference between your method and mine.

---

No, your method did not include all of those sequences because I compared the numbers you gave. Your calculation was the equivalent of the second one in my example - effectively reducing the sequence length by 20% (the exponent was multiplied by 0.8).As I have shown this is clearly incorrect, and underestimates the number of sequences.

quote:

---

And I did that for the bacterial flagellum of E. Coli. If other flagella have a different complexity, than they haev a different amoutn of CSI.

---

As I have pointed out the complexity belongs to the specification. (Naturally you cannot include any information outside of the specification as specified information !). Thus if the numbers come out differently you have done the calculations incorrectly.

quote:

---

You can't detach the patternt of a salt crystal. Meaning, you can only describe it by looking at the crystal itself. Therefore, it's not a spcification. If you could describe the pattern the salt crystal exhibited without looking at the crystal itself, than it would be a specification.

---

Of course I can seperate the specification from the salt crystal. "face-centred cubic lattice" is a purely geometric description. And I don't have to look at any specific salt crystal to know that it will have that structure.

quote:

---

"Selecting Democrats over Republicans 40 out of 41 times in ballots" describes the event perfectly.

---

So you are saying that given the description "Selecting Democrats over Republicans 40 out of 41 times in ballots" you can work out the exact sequence of results ? Because if you aren't then it doesn't describe the event perfectly - it leaves out a detail.

quote:

---

I knwo it gorws with high probability! But that does nto account for the flagellum's DNA! It's there without it growing or not. How did it get there?

---

It would be easier to have a productive discussion if you would cease flip-flopping on this issue. If you want to look at the origins of the information that is used to grow the flagellum than you have to look at that - just looking at the final structure of the flagellum will not tell you nearly enough. If you don't want to look at that - as you said - then you will just have to accept that flagella grow, and you cannot ignore that fact.

quote:

---

I didn't say all! I said almost radeall mutations degrade genetic information. On average they degrade the information, therefore, the chances are higher that they will degrade it when a mutation happens. And since natural selection is not perfect, they will accumulate. That is my argument.

---

Since you haven't even offered a meaningful definition of this "degradation" let alone a valid reason to think that "almost all" mutations - including beneficial mutations "degrade" genetic information there doesn't seem to be much of an argument there.

quote:

---

My argument was that Kimura said that slightly deleterious/nearly neutral mutations are invisible to natural seelction. And that's true.

---

It isn't supported by the quote - in fact the quote bases the claim of "invisibility" on an assumption of absolute neutrality, which is in agreement with my position.

quote:

---

Look at teh last statement: "As a result, the theory regards these genomic features as neither subject to, nor explicable by, natural selection."

---

I have, and it tells me that you've got nothing. Even you can see that it makes no mention of genetic meltdown.

But over a span of 3.5 billion years the genome has not suffered this major disaster you seem to be counting on.Why not? Surely that is enough time for something so deleterious to manifest itself, is it not?Or is this genetic entropy just nonsense? Likewise.This one fact, that I have pointed out several times now, demolishes your whole argument. There is no need for mathematical modeling or anything else--either you can explain--in detail--why 3.5 billion or so years isn't sufficient for your genetic meltdown to occur, or admit that it isn't going to occur at all.Ignoring my posts isn't going to make this one pesky fact go away.

---

Religious belief does not constitute scientific evidence, nor does it convey scientific knowledge.